search for




 

The Incidence of Alternaria Species Associated with Infected Sesamum indicum L. Seeds from Fields of the Punjab, Pakistan
The Plant Pathology Journal 2017;33:543-553
Published online December 1, 2017
© 2017 The Korean Society of Plant Pathology.

Brian Gagosh Nayyar1,*, Steve Woodward2, Luis A. J. Mur3, Abida Akram1, Muhammad Arshad1, S. M. Saqlan Naqvi4, and Shaista Akhund1

1Department of Botany, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi 46300, Pakistan, 2Institute of Biological and Environmental Sciences, University of Aberdeen, Cruikshank Building, St. Machar Drive, Aberdeen AB24 3UU, Scotland, UK, 3Institute of Biological, Rural and Environmental Sciences, Aberystwyth University, Edward Llwyd Building, Penglais Campus, Aberystwyth SY23 3DA, Wales, UK, 4Department of Biochemistry, Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi 46300, Pakistan
Correspondence to: Phone) +92-334-809-8095, FAX) +92-51-9290160, E-mail) brian_gagosh@hotmail.com
Received April 10, 2017; Revised July 9, 2017; Accepted July 23, 2017.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Sesame (Sesamum indicum) is an important oil seed crop of Asia. Yields can be negatively impacted by various factors, including disease, particularly those caused by fungi which create problems in both production and storage. Foliar diseases of sesame such as Alternaria leaf blight may cause significant yield losses, with reductions in plant health and seed quality. The work reported here determined the incidence of Alternaria species infecting sesame seeds grown in the Punjab, Pakistan. A total of 428 Alternaria isolates were obtained from 105 seed samples and grouped into 36 distinct taxonomic groups based on growth pattern and morphological characters. Isolation frequency and relative density of surface sterilized and non-surface sterilized seeds showed that three isolates (A13, A47 and A215) were the most common morphological groups present. These isolates were further identified using sequencing of the Internal Transcribed Spacer (ITS) region of ribosomal DNA (rDNA) and the Alternaria major allergen gene (Alt a 1). Whilst ITS of rDNA did not resolve the isolates into Alternaria species, the Alt a 1 sequences exhibited > 99% homology with Alternaria alternata (KP123850.1) in GenBank accessions. The pathogenicity and virulence of these isolates of Alternaria alternata was confirmed in inoculations of sesame plants resulting in typical symptoms of leaf blight disease. This work confirms the identity of a major source of sesame leaf blight in Pakistan which will aid in formulating effective disease management strategies.

Keywords : Alternaria, Alt a 1 gene, ITS, Punjab, sesame seeds
Introduction

Sesame (Sesamum indicum L.) is one of the oldest and most important oilseed crops, mainly grown for its oil and protein content (Johnson et al., 1979). This crop is an important source of fats, proteins, vitamins and minerals in the food of rural people, particularly children, throughout the world (Shahidi et al., 2006). Sesame seed contains oil (48 to 60%), protein (18 to 23.5%), carbohydrate (13.5%), and ash (5.3%), with a moisture content of approximately 5.2% (Obiajunwa et al., 2005; Kahyaoglu and Kaya, 2006). Sesame oil contains the antioxidants sesamoline, sesamin and sesamol (Pastorello et al., 2001). Sesame oil is used in cuisine for salad dressings and the manufacturing of margarine, and is a raw ingredient in industry for making paints, varnishes, soaps, perfumes, insecticides, and pharmaceuticals as a vehicle for drug delivery (Grubben and Denton, 2004).

Cultivation of sesame probably originated in the Harappa Valley region of the Indian subcontinent as long as ago as pre-3000 BC (Ashri, 2007). Currently, sesame is grown commercially in 76 countries in the world but production is mostly dominated by Asian and African countries (Ashri, 1998). India, Sudan and China are the leading producers of sesame, followed by Myanmar, Nigeria, Ethiopia, Uganda, Mexico, Pakistan, Bangladesh, Thailand, Turkey (FAO, 2014). In Pakistan, sesame is grown in all four provinces, but 89% of production is in the Punjab, which is considered a major sesame producing area in South Asia (The Financial Daily, 2017).

Numerous microorganisms, especially fungi, pose a challenge to both sesame production and seed storage. Sesame agriculture faces numerous disease problems, including vascular wilt, root rot, leaf blight, leaf spot and damping off in young seedlings (Farhan et al., 2010). Previous reports have shown the presence of Aspergillus and Fusarium in sesame seeds (Mbah and Akueshi, 2000, 2001). However, sesame is also susceptible to leaf blight caused by Alternaria sesami (Kolte, 1985), which is also seed-borne (Richardson, 1979). Leaf diseases of sesame, such as blight diseases caused by Alternaria spp. result in substantial loss in yield and deterioration in quality and vigor of seed (Enikuomehin et al., 2002). Of particular economic importance is leaf blight caused by Alternaria sesami and A. alternata (Chohan, 1978), which also causes seed rot and pre- and post-emergence damping-off, as well as infecting all aerial plant parts, resulting in considerable losses in yield, both qualitative and quantitative (Naik et al., 2004). Alternaria leaf spot of sesame has been recognized as a major biotic pressure of single origin limiting yields (Lubaina and Murugan, 2013). Symptoms of Alternaria leaf blight include the formation of round to irregular spots of up to 10 mm diameter. Individual spots may coalesce to form large necrotic patches, resulting in premature abscission (Rao and Vijayalakshmi, 2000). Alternaria species are dispersed from region to region through various pathways which include air-borne conidia and adherence of soil to seedlings, farm equipment, or animals (Ojiambo, 1997).

Alternaria species produce non-host specific (e.g., tenuazonic acid (TeA), alternariol (AOH), alternariol monomethyl ether (AME), brefeldin A, tentoxin, zinniol) (Saha et al., 2012) as well as host-specific toxins (Thomma, 2003) which contaminate the product. Consumption of foodstuff contaminated with Alternaria toxins has been implicated in elevated incidence of esophageal carcinoma in humans (Schrader et al., 2001). The wide distribution, high variability and influence of Alternaria spp. on crops and humans warrants accurate identification of the causal agents to formulate effective control and management strategies (Hong et al., 2005b).

The aim of the work described in this paper was to determine the Alternaria species associated with sesame in the Punjab, Pakistan, as an example of the source of yield losses affecting production of this important crop in South Asia. To the best of our knowledge, no such studies have been carried out to date in the Punjab. This basic work on testing seeds for the presence of seed-borne pathogens is an important step in the development of disease management strategies for this crop.

Materials and Methods

Plant Material and Fungal Isolation

One hundred and five seed samples of sesame were collected from the major sesame growing areas of the Punjab, Pakistan (Fig. 1). Seeds for isolating fungi were selected randomly from within a batch and 50% of seeds were surface sterilized in 5% NaOCl for 2 mins. Surface sterilized and unsterilized seeds were placed at the rate of 25 seeds into 90 mm diameter Petri dishes with three layers of well-moistened filter paper discs (Whatman™ 1001–090 Grade 1). Petri dishes were incubated at 22 ± 2°C for seven days with an alternate cycle of light and darkness (12 h each) in a Versatile Environmental Test Chamber (Sanyo, Japan); illumination was provided by 55W fluorescent lights (Sylvania, Germany) giving a light intensity of 125–130 μmol m−2 s−1. The experiment was performed in triplicate. After incubation, emerging fungal colonies were counted and isolated onto potato dextrose agar (PDA, Oxoid, UK) amended with 100 mg L−1 streptomycin (Singleton et al., 1993). Isolates were maintained on PDA and identified on the basis of morphological characters (Ellis, 1971, 1976; Simmons, 2007).

Isolation frequency (Fr) and relative density (RD) of fungi in and on seeds were calculated as follows:

Fr (%)=(ns)N×100         RD (%)=(ni)N×100

Where, ns is the number of samples on which a fungus occurred; N is the total number of seeds sampled; ni is the number of isolates of a fungal genus/species, and Ni is the total number of fungal isolates obtained.

Fungal DNA Extraction, PCR amplification, and Sequencing

Genomic DNA of representative isolates of the three most frequent groups of Alternaria (A13, A47, and A215) was extracted by scraping the surface of 14 days old cultures grown on PDA. DNA was extracted from 50 mg mycelium per isolate using “Plant DNeasy Mini Kit” (Qiagen, UK) by homogenizing in liquid nitrogen and following the manufacturer’s protocol. DNA concentration was measured by a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc., Montchanin, DE, USA) and the final concentration of DNA was adjusted to 100 ng/μl for PCR amplification. The Internal Transcribe Spacer (ITS) region of rDNA and Alt a 1 gene were amplified using ITS1 (TCCGTAGGTGAACCTGCGG) / ITS4 (TCCTCCGCTTATTGATATGC) (White et al., 1990) and Alt-for (ATGCAGTTCACCACCATCGC) / Alt-rev (ACGAGGGTGAYGTAGGCGTC) primers (Hong et al., 2005a), respectively.

PCR was performed in a 25 μl reaction mixture containing 12.5 μl BioMix (Bioline), 0.5 μl each primer, 2 μl template DNA and 9.5 μl pure water. PCR was performed in a MyCycler™ Thermal cycler (Bio-Rad, USA) with initial denaturation at 95°C for 3 mins followed by 35 cycles of 94°C for 30s, 55°C for 30 s and 72°C for 1 min and a final elongation step at 72°C for 10 min for ITS amplification. For the Alt a 1 gene amplification, an initial denaturation at 94°C for 1 min was followed by 35 cycles of 94°C for 30 s, annealing at 57°C for 30 s, 72°C for 1 min, and a final extension at 72°C for 10 min. Amplified fragments were loaded on an agarose gel (1% w/v) stained with SYBR® Safe DNA gel stain (Invitrogen, USA), visualized under UV light and purified with a “Qiaquick PCR Purification kit” (Qiagen, UK), following the manufacturer’s protocol. Amplicons were sequenced by Source BioScience (UK) in both directions and the sequences analyzed using MEGA 7 software (Kumar et al., 2016) and blasted against the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Phylogenetic Analysis

The phylogeny for each genus was reconstructed using the Maximum Likelihood (ML) method based on the Tamura-Nei model (Tamura and Nei, 1993). The bootstrap consensus tree inferred from 500 replicates was taken to represent the evolutionary history of the taxa analyzed. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with a superior log likelihood value. Evolutionary analyses were conducted in MEGA 7 (Kumar et al., 2016).

Pathogenicity Testing

Spore suspensions were prepared by flooding PDA cultures with sterile distilled water amended with two drops of Tween 20 per 100 ml and the spore concentration was adjusted to 106 conidia ml−1 using replicate hemocytometer counts. For the pathogenicity test, sesame seeds were sown in a glasshouse under natural light conditions (14 h photoperiod, 25–32°C). Ten sterilized seeds per pot were sown in a soil - sand - farmyard manure mixture (2:1:1 w/w). Plants, 4-weeks old, were sprayed to run off with the spore suspension using a spray bottle and covered with plastic bags to maintain high humidity for 24 h. Symptoms were evaluated 7 days after inoculation. Plants were rated for the presence (+) or absence (−) of 2- to 5-mm-diameter spots of irregular shape, dark brown to grey in color and surrounded by a bright yellow margin. Three replicate pots for each isolate were tested. To verify the ability of the Alternaria spp. isolates to colonize the host tissues, re-isolations were made from the lesions onto PDA to fulfill Koch’s postulates. In addition, disease severity (DS) was scored on a revised rating system from Zhao et al. (2016): 0 = no symptoms on leaves; 1 = 0–25% infection on leaves; 2 = 25–50% infection on leaf area. Disease severity index (DSI) was calculated as ∑ (disease severity scale points × number of plants at each scale point) / (total number of seedlings assessed × disease severity scale of the highest scale point observed) × 100 (Zhao et al., 2014).

Effect of Culture Filtrate on Seed Germination and Seedling Growth

Erlenmeyer flasks containing 50 ml of potato dextrose broth (Sigma Aldrich, USA; catalog number P-6685; prepared using 24 g/L and autoclaved at 121°C for 15 minutes) were inoculated with the test fungi and incubated at 28°C. After 5 days, the culture broth and fungal mycelia were carefully separated. A 50 ml volume of 3:2:1 (v/v/v) ethyl acetate: chloroform: methanol was added to each flask containing culture broth, followed by shaking overnight on a rotary shaker. Extracts were centrifuged at 5000 rpm for 30 minutes and the supernatant incubated in a water bath at 45°C for 8–10 h to concentrate the extract to a volume of 10 ml (Jaiswal et al., 2012).

Sesame seeds were surface sterilized in 5% sodium hypochlorite for two minutes followed by 3 rinses in sterile distilled water before suspending in culture filtrates (10 ml). Following incubation at 28 ± 2°C for 24 h, seeds were removed from the filtrate extract and washed once in sterile distilled water. Treated seeds were plated on 1.5% water agar in 90 mm diameter Petri dishes, with 10 seeds per dish. Control seeds were treated with distilled water prior to plating on 1.5% water agar. After 7 days of incubation, shoot and root lengths were recorded. In addition, a vigor index was calculated (Jalander and Gachande, 2012) following the formulae:

Germination %=Germinated seeds of treatment/Germinated seeds of control×100Vigor index =Seed germination (%)×Seeding Length (Shoot+Root Length)
Results

Morphological Identification of Alternaria species

A total of 428 isolates of Alternaria were recovered from sesame seeds collected in the Punjab, Pakistan. Seeds were selected from plants exhibiting blight symptoms on leaves (Fig. 1B) and pods (Fig. 1C). These isolates were cultured to homogeneity: all isolates developed loose, cottony and greyish-green to olive brown colonies on PDA after incubation at 25°C for 7 days in the dark (Fig. 2A, B, C). Isolates were grouped morphologically, based on well-established features of Alternaria species, focusing on colony characteristics and conidial structure (Fig. 2). Based on these features, the isolates were placed into 36 morphological groups and identified as far as possible. Isolates produced conidia as solitary or in short chains. Conidia were narrow-obclavate, ovoid or ellipsoid with 1–2 longi-septa.

The mean isolation frequency and relative density of each isolate form was determined in 100 non-surface sterilized and in 100 surface sterilized seeds. It was observed that majority of isolates were obtained from Gujranwala followed by Hafizabad, Gujrat and Mandi Bahuddin. Quantitatively three isolate groups (A13, A47, A215) were found most frequently (Table 1) and selected for further analyses.

Identification by DNA sequencing

PCR amplification of the ITS regions of rDNA yielded fragments of ~550 bp from all tested Alternaria isolates. PCR of the Alt a 1 gene gave fragments of ~500 bp in length from all isolates. BLAST searches on NCBI showed the ITS sequences to be 100% identical to those of Alternaria isolates described as “Alternaria sp.” but also matched precisely with named species including A. alternata, A. longipes and A. brassicae. Phylogenetic analysis using ITS sequences failed to differentiate the isolates, grouping all 3 into a single clade (Fig. 3), with the reference sequences of A. alternata (KJ735925.1), A. brassicae (KJ728842.1) and A. longipes (KJ722535.1) obtained from GenBank. In contrast, sequences of the Alt a 1 gene showed > 99% homology with Alternaria alternata and phylogenetic analysis placed the isolates in a clade close to the reference sequence of Alternaria alternata (KP123850.1; Fig. 4). Similarly, some morphological characters of selected isolates (A13, A47 and A215) showed homology with colony and conidial characters of A. alternata. However, the Alt a 1 sequence of strain A13 indicated that it was distinct from the A. alternata clade. Sequences from the isolates obtained in this work were submitted to GenBank (Table 2).

Pathogenicity Tests

Seven days after inoculation with a spore suspension of the Alternaria isolates, brown lesions surrounded by yellow haloes began to develop on sesame leaves; disease symptoms gradually spread from leaf margins to the midveins, similar to symptoms observed in the sesame fields during the sample collection. In a later stage, blight extended to the center of the leaves and plants became defoliated (Fig. 5). Extended necrosis surrounded by yellowing was usually observed on diseased leaves. Pathogenicity tests confirmed that all tested isolates were virulent leaf blight pathogens, the most virulent being A13 (Table 3). No symptoms developed on control plants. The Alternaria isolates were reisolated from symptomatic leaves of inoculated plants, but not from any of the control plants.

Effect of Culture Filtrates on Seed Germination

Seed germination and vigor of sesame seedlings were adversely affected by the culture filtrates of isolate A13 (Fig. 6). The reduction in seed germination ranged from 40–60%, while vigor index in samples treated with filtrates of this isolate was 4% compared with over 62% in control plants (Table 4).

Discussion

This work clearly demonstrated that Alternaria species are present in a high proportion of sesame seeds collected from various regions in the Punjab, Pakistan, suggesting that there is a potential source of inoculum to initiate disease outbreaks under conditions favorable to pathogen development. The most common species of Alternaria found in the present work was A. alternata. Species delineation within the genus Alternaria requires careful attention in order to determine the range of species causing diseases on a given host.

Amongst the species of Alternaria identified morphologically, three representatives, chosen from the most commonly occurring groups (A13, A47, A215), were initially identified as Alternaria sesami, Alternaria longipes and Alternaria brassicae, respectively, on the basis of conidial morphology and colony characteristics. Identification of Alternaria species based on morphological criteria, however, remains a challenging task, leading to controversy and confusion very often accompanying classification in this genus (Maraite et al., 1998). This problem is especially relevant for the small-spored species, which share morphological characteristics such as having overlapping conidial size ranges (Simmons, 1992). Although the ITS region of rDNA is widely used as a barcode for fungi (Blaalid et al., 2013), the sequences of the Alternaria isolates analyzed here were 100% identical to those of “Alternaria sp.” in Genbank, but were also identical to those of other Alternaria species, including A. alternata, A. longipes or A. brassicae. It has been recognized that ITS sequences are not always able to differentiate at the species level in the genus Alternaria (Pryor and Michailides, 2002; Shipunov et al., 2008; Zur et al., 2002).

In contrast, use of the partial coding sequence of the Alternaria major allergen gene (Alt a 1 gene) in PCR enabled accurate identification to the species level, confirming that all three isolates tested were Alternaria alternata, in agreement with other workers studying different hosts for this genus of pathogens (Guo-yin et al., 2013; Paul et al., 2015; Skóra et al., 2015). It has been suggested that the Alt a 1 gene sequence evolved 3.8 times faster and contained 3.5 times more parsimony-informative sites than glyceraldehyde-3-phosphate dehydrogenase (gpd) sequences, strongly supporting the use of this part of the genome for species identification in Alternaria (Hong et al., 2005a).

Based on this work, therefore, it can be concluded that Alternaria alternata is a destructive pathogen causing leaf blight on sesame in the Punjab, Pakistan. The incidence of Alternaria alternata in sesame seed was high compared to other species of Alternaria isolated from this host plant. Most Alternaria spp., including A. alternata, exhibit considerable morphological plasticity depending on cultural conditions, including substrate, temperature, light and humidity. These fungi, therefore, in particular A. alternata, can be frequently misidentified when relying on morphological characteristics alone (Misaghi et al., 1978; Roberts et al., 2000; Simmons, 1992). Moreover, the inoculation tests carried out with the three isolates of Alternaria alternata confirmed pathogenicity and virulence, with the development of leaf blight in sesame, similar to the results reported with A. longipes by Shoaib et al (2014).

The wide variability among different Alternaria species from different hosts has been reported previously (Kumar et al., 2008; Pryor and Gilbertson 2000; Pryor and Michailides, 2002; Quayyum et al., 2005). Among the different diseases caused by species in the genus Alternaria, leaf blight disease is one of the most important, causing yield loss in the range of 32–57% per annum in canola, for example (Conn and Tewari, 1990). In the present study, symptoms of the disease on sesame include the presence of irregular, often circular brown to dark brown colored spots on the leaves, with concentric lines inside the spots which are in agreement with the findings of Valkonen and Koponen (1990) who reported that individual circular spots may coalesce to form large patches, resulting in leaf blight of Chinese cabbage. In some infections, small dark colored spots are formed on pods and young shoots of Chinese cabbage.

An important conclusion drawn from the work presented in this paper is that identification of Alternaria spp. on the basis of morphological characteristics alone is unreliable for correct determination of species. More stringent identification was possible using species-specific primers, which are required in diagnostics for sesame seed testing: ITS sequences were not sufficiently discriminatory to separate species.

Acknowledgments

This work was supported by the Higher Education Commission (HEC) of Pakistan under the National Research Program for Universities (NRPU) project No. 20-5166. Moreover, HEC is also acknowledged for providing funds to the first author (IRSIP No. 1-8/HEC/HRD/20143411) to visit Department of Plant and Soil Science, University of Aberdeen, Scotland, UK. First two authors are thankful to the Govt. of Scotland for providing the import license for three Alternaria isolates under Directive 2008/61/EC and Scottish License No. PH/9/2015.

Figures
Fig. 1. (A) Sampling sites in the Punjab, Pakistan. (B) Typical leaf blight symptoms on sesame leaves in the field and (C) pods (arrowed) during the sampling in the Punjab, Pakistan.
Fig. 2. (A–C) Colony morphology of three most frequent Alternaria isolates (A13, A47, A215) obtained from sesame seeds on PDA. (D–F) Conidia of three most frequent Alternaria isolates (Bar = 10 μm).
Fig. 3. Maximum likelihood phylogenetic tree obtained from consensus sequences of Alternaria isolates from sesame seeds using ITS rDNA primers. Numbers above the branches are bootstrap values from 500 replicates. The scale indicates the genetic distance between the species.
Fig. 4. Maximum likelihood phylogenetic tree obtained from consensus sequences of Alternaria isolates from sesame seeds using Alt-forward and reverse primers. Numbers above the branches are bootstrap values from 500 replicates. The scale indicates the genetic distance between the species.
Fig. 5. Symptoms produced by three isolates of Alternaria on leaves of sesame plants 7 days after inoculation. (A) Control; (B) A13; (C) A47; (D) A215.
Fig. 6. Effect of cultural filtrates of Alternaria isolates on the germination of sesame seeds after 7 days of incubation. (A) Control; (B) A13; (C) A47; (D) A215.
Tables

Morphological characterization, isolation frequency and relative density of Alternaria isolates from sesame seeds

Isolate codeName of fungiOrigin (city)Non sterilized seedsSurface sterilized seeds

No. of isolatesFrRDNo. of isolatesFrRD
A6Alternaria dianthiSialkot5102.14462.06
A13Alternaria sesamiSialkot582424.79324016.49
A19Alternaria citriSialkot13185.56582.58
A47Alternaria longipesGujranwala17787.2619409.79
A91Alternaria dianthicolaGujranwala17247.267103.61
A166Alternaria brassicicolaGujranwala682.56324016.49
A181Alternaria solaniGujranwala7102.99321.55
A183Alternaria raphaninGujranwala000.00120.52
A196Alternaria alternataGujranwala13185.56562.58
A203Alternaria dianthicolaHafizabad16226.84462.06
A215Alternaria brassicaeHafizabad18267.69302615.46
A217Alternaria citriHafizabad220.85000.00
A218Alternaria infectoriaHafizabad341.28000.00
A220Alternaria sesamicolaGujrat17247.26683.09
A221Alternaria helianthiGujrat9123.85683.09
A228Alternaria longissimiGujrat10144.27341.55
A236Alternaria raphaninGujrat441.71120.52
A239Alternaria tenuissimaAttock7102.99000.00
A249Alternaria triticinaAttock000.0019269.79
A261Alternaria radicinaMandi Bahuddin441.71482.06
A263Alternaria pluriseptataMandi Bahuddin361.28221.03
A267Alternaria cinerariaeMandi Bahuddin240.85582.58
A272Alternaria chlamydosporaMandi Bahuddin341.28663.09

Fr = Isolation frequency; RD = relative density.


Molecular Identification of three most frequent Alternaria isolates obtained from sesame seeds

Isolate codeOrigin (city)Morphological identificationMolecular identificationNCBI accession no.

ITSAlt a 1ITSAlt a 1
A13SialkotAlternaria sesamiAlternaria sp.Alternaria alternataKY190101KY124234
A47GujranwalaAlternaria longipesAlternaria sp.Alternaria alternataKY190102KY124235
A215HafizabadAlternaria brassicaeAlternaria sp.Alternaria alternataKY190103KY124236

Pathogenicity test of Alternaria isolates (A13, A47 and A215) on sesame seedlings

InfectionTotal leavesInfected leavesDisease incidence (%)Disease severity incidenceNo. of lesions/leafArea of lesions (cm)Area of leafInfection (%)Rating scale
A137228.528.5720.491.5531.612
A479222.212.1120.221.1618.971
A215101102010.51.1942.022

Effects of culture filtrates from Alternaria isolates (A13, A47 and A215) on germination of sesame seeds and growth of seedings

TreatmentGermination %Root length (cm)Shoot length (cm)Vigor index
A1340.000.100.004.00
A4760.000.400.9024.90
A21553.330.200.0010.67
Control86.670.701.5062.17

Vigor index = Seed germination (%) × Seedling Length (Shoot + Root Length).

References
  1. Ashri, A (2007). Sesame (Sesamum indicum L.). Genetic resources, chromosomes engineering, and crop improvement, Singh, RJ, ed. Boca Raton, FL, USA: CRC Press, pp. 231-289
  2. Ashri, A (1998). Sesame Breeding. Plant breeding reviews, Janick, J, ed. Oxford, UK: John Wiley & Sons, Inc, pp. 179-228
  3. Blaalid, R, Kumar, S, Nilsson, RH, Abarenkov, K, Kirk, PM, and Kauserud, H (2013). ITS1 versus ITS2 as DNA metabarcodes for fungi. Mol Ecol Resour. 13, 218-224.
    Pubmed CrossRef
  4. Chohan, JS (1978). Diseases of oil seed crops, future plans and strategy for control under small holdings. Indian Phytopathol. 31, 1-15.
  5. Conn, KL, and Tewari, JP (1990). Survey of Alternaria blackspot and Sclerotinia stem rot in central Alberta in 1989. Can Plant Dis Surv. 70, 66-67.
  6. Ellis, MB (1971). Dematiaceous hyphomycetes. Kew, Surrey, UK: Commonwealth Mycological Institute, pp. 608
  7. Ellis, MB (1976). More dematiaceous hyphomycetes. Kew, Surrey, UK: Commonwealth Mycological Institute, pp. 507
  8. Enikuomehin, OA, Olowe, VIO, Alao, OS, and Atayese, MO (2002). Assessment of Cercospora leaf spot disease of sesame in different planting dates in South-Western, Nigeria. Moor J Agric Res. 3, 76-82.
  9. FAO (2014). FAOSTAT databases.URL http://www.fao.org/faostat/en/#data/QC/
  10. Farhan, HN, Abdullah, BH, and Hameed, AT (2010). The biological activity of bacterial vaccine of Pseudomonas putida 2 and Pseudomonas fluorescens 3 isolates to protect sesame crop (Sesamum indicum) from Fusarium fungi under field conditions. Agric Biol J N Am. 1, 803-811.
    CrossRef
  11. Grubben, GJH, and Denton, OA (2004). Plant resources of tropical Africa 2: vegetables. Wageningen, Netherlands: PROTA Foundation, pp. 668
  12. Guo-yin, T, Zhi-ling, Y, Zhi-lin, Y, and Shou-an, Z (2013). Morphological, molecular and pathogenic characterization of Alternaria longipes, the fungal pathogen causing leaf spot on Atractylodes macrocephala. Afr J Microbiol Res. 7, 2589-2595.
    CrossRef
  13. Hong, SG, Cramer, RA, Lawrence, CB, and Pryor, BM (2005a). Alt a 1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure. Fungal Genet Biol. 42, 119-129.
    CrossRef
  14. Hong, SG, Liu, D, and Pryor, BM (2005b). Restriction mapping of the IGS region in Alternaria spp reveals variable and conserved domains. Mycol Res. 109, 87-95.
    CrossRef
  15. Jaiswal, S, Saini, R, Sangani, SR, Tiwari, S, Agrawal, M, and Agrawal, MK (2012). Antibacterial activity of five fungal strains isolated from a leguminous soil field against nitrogen-fixing bacteria. Ann Biol Res. 3, 2829-2837.
  16. Jalander, V, and Gachande, BD (2012). Effect of fungal metabolites of some rhizosphere soil fungi on seed germination and seedling growth of some pulses and cereals. Sci Res Repot. 2, 265-267.
  17. Johnson, LA, Suleiman, TM, and Lusas, EW (1979). Sesame protein: a review and prospectus. J Am Oil Chem Soc. 56, 463-468.
    Pubmed CrossRef
  18. Kahyaoglu, T, and Kaya, S (2006). Modeling of moisture, color and texture changes in sesame seeds during the conventional roasting. J Food Eng. 75, 167-177.
    CrossRef
  19. Kolte, SJ (1985). Diseases of annual edible oil seed crops. Rapeseed, mustard, safflower and sesame diseases. Boca Raton, FL, USA: CRC Press Inc, pp. 221-232
  20. Kumar, V, Haldar, S, Pandey, KK, Singh, RP, Singh, AK, and Singh, PC (2008). Cultural, morphological, pathogenic and molecular variability amongst tomato isolates of Alternaria solani in India. World J Microbiol Biotechnol. 24, 1003-1009.
    CrossRef
  21. Kumar, S, Stecher, G, and Tamura, K (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol. 33, 1870-1874.
    Pubmed CrossRef
  22. Lubaina, AS, and Murugan, K (2013). Physiological and biochemical characterization of Senna alata (L.) Roxb. leaf extract - a plant based fungicide against Alternaria leaf spot in sesame. World J Pharm Pharm Sci. 2, 5790-5801.
  23. Maraite, H, Di Zinno, T, Longree, H, Daumerie, V, and Duveiller, E (1998). Fungi associated with foliar blight of wheat in warm areas. Helminthosporium blights of wheat: spot blotch and tan spot, Duveiller, E, Dubin, HH, Reeves, J, and McNab, A, ed. Mexico: CIMMYT, pp. 293-300
  24. Mbah, MC, and Akueshi, CO (2000). Effect of seed borne fungi Aspergillus flavus and Aspergillus niger on the germinability of sesame seeds. Niger J Hort Soc. 4, 57-64.
  25. Mbah, MC, and Akueshi, CO (2001). Some physico-chemical changes induced by Aspergillus flavus and Aspergillus niger on Sesamum indicum and Sesamum radiatum. J Sci Agric Food Technol Environ. 1, 65-69.
  26. Misaghi, IJ, Grogan, RG, Duniway, JM, and Kimble, KA (1978). Influence of environment and culture media on spore morphology of Alternaria alternata. Phytopathology. 68, 29-34.
    CrossRef
  27. Naik, MK, Patil, RG, Suvarna, , and Ajithkumar, K (2004). Yield loss model and blight prediction model in Alternaria blight of sesame. Indian Phytopathology. 57, 106.
  28. Obiajunwa, EI, Adebiyi, FM, and Omode, PE (2005). Determination of essential minerals and trace elements in Nigerian sesame seeds, using TXRF Technique. Pak J Nutr. 4, 393-395.
    CrossRef
  29. Ojiambo, PS 1997. Cultural studies and epidemiology of Alternariasesami and significance of sesame (Sesamum indicum L.) seed transmission and plant age on Alternaria leaf spot severity. MSc thesis. University of Nairobi. Nairobi, Kenya. pp.111.
  30. Pastorello, AE, Varin, E, Farioli, L, Pravettoni, V, Ortolani, C, Trambaioli, C, Fortunato, D, Giuffrida, MG, Rivolta, F, Robino, A, Calamari, AM, Lacava, L, and Conti, A (2001). The major allergen of sesame seeds (Sesamum indicum) is a 2S albumin. J Chromatogr B Biomed Sci Appl. 756, 85-93.
    Pubmed CrossRef
  31. Paul, NC, Deng, JX, Lee, HB, and Yu, SH (2015). Characterization and pathogenicity of Alternaria burnsii from seeds of Cucurbita maxima (Cucurbitaceae) in Bangladesh. Mycobiology. 43, 384-391.
    CrossRef
  32. Pryor, BM, and Gilbertson, RL (2000). Molecular phylogenetic relationship amongst Alternaria species and related fungi based upon analysis of nuclear ITS and mt SSU rDNA sequences. Mycol Res. 104, 1312-1321.
    CrossRef
  33. Pryor, BM, and Michailides, TJ (2002). Morphological, pathogenic, and molecular characterization of Alternaria isolates associated with Alternaria late blight of pistachio. Phytopathology. 92, 406-416.
    CrossRef
  34. Quayyum, HA, Dobinson, KF, and Traquair, JA (2005). Conidial morphology, virulence, molecular characterization, and host-parasite interactions of selected Alternaria panax isolates on American ginseng. Can J Bot. 83, 1133-1143.
    CrossRef
  35. Rao, NR, and Vijayalakshmi, M (2000). Studies on Alternaria sesami pathogenic to sesame. Microbiol Res. 155, 129-131.
    Pubmed CrossRef
  36. Richardson, MJ (1979). An annotated list of seed borne diseases. Zurich, Switzerland: International Seed Testing Association, pp. 320
  37. Roberts, RG, Reymond, ST, and Andersen, B (2000). RAPD fragment pattern analysis and morphological segregation of small-spored Alternaria species and species groups. Mycol Res. 104, 151-160.
    CrossRef
  38. Saha, D, Fetzner, R, Burkhardt, B, Podlech, J, Metzler, M, Dang, H, Lawrence, C, and Fischer, R (2012). Identification of a polyketide synthase required for alternariol (AOH) and alternariol-9-methyl ether (AME) formation in Alternaria alternata. PLoS One. 7, e40564.
    Pubmed KoreaMed CrossRef
  39. Schrader, TJ, Cherry, W, Soper, K, Langlois, I, and Vijay, HM (2001). Examination of Alternaria alternata mutagenicity and effects of nitrosylation using the Ames Salmonella Test. Teratog, Carcinog Mutagen. 21, 261-274.
    Pubmed CrossRef
  40. Shahidi, F, Liyana-Pathirana, CM, and Wall, DS (2006). Antioxidant activity of white and black sesame seeds and their hull fractions. Food Chem. 99, 478-483.
    CrossRef
  41. Shipunov, A, Newcombe, G, Raghavendra, AK, and Anderson, CL (2008). Hidden diversity of endophytic fungi in an invasive plant. Am J Bot. 95, 1096-1108.
    Pubmed CrossRef
  42. Shoaib, A, Akhtar, N, Akhtar, S, and Hafeez, R (2014). First report of Alternaria longipes causing leaf spot of potato cultivar sante in Pakistan. Plant Dis. 98, 1742.
    CrossRef
  43. Simmons, EG (2007). An identification manual. Utrecht, Netherlands: CBS Fungal Biodiversity Centre, pp. 775
  44. Simmons, EG (1992). Alternaria taxonomy: current status, viewpoint, challenge. Alternaria biology, plant diseases and metabolites, Chelkowski, J, and Visconti, A, ed. Amsterdam, Netherlands: Elsevier Science Publishers, pp. 1-35
  45. Singleton, LL, Mihail, JD, and Rush, CM (1993). Methods for research on soil borne phytopathogenic fungi. St. Paul: American Phytopathological Society, pp. 266
  46. Skóra, J, Otlewska, A, Gutarowska, B, Leszczyńska, J, Majak, I, and Stępień, Ł (2015). Production of the allergenic protein Alt a 1 by Alternaria isolates from working environments. Int J Environ Res Public Health. 12, 2164-2183.
    Pubmed KoreaMed CrossRef
  47. Tamura, K, and Nei, M (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 10, 512-526.
    Pubmed
  48. Thomma, BP (2003). Alternaria spp.: from general saprophyte to specific parasite. Mol Plant Pathol. 4, 225-236.
    Pubmed CrossRef
  49. Valkonen, JPT, and Koponen, H (1990). The seed-borne fungi of Chinese cabbage (Brassica pekinensis), their pathogenicity and control. Plant Pathol. 39, 510-516.
    CrossRef
  50. White, TJ, Bruns, T, Lee, S, and Taylor, JW (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, Innis, MA, Gelfand, DH, Sninsky, JJ, and White, TJ, ed. New York, USA: Academic Press, Inc., pp. 315-322
  51. Zhao, B, Yan, J, Zhang, S, Liu, X, and Gao, Z (2014). Phylogeny and pathogenicity of Fusarium spp. isolated from greenhouse melon soil in Liaoning Province. Saudi J Biol Sci. 21, 374-379.
    Pubmed KoreaMed CrossRef
  52. Zhao, J, Bao, S, Ma, G, and Wu, X (2016). Characterization of Alternaria species associated with muskmelon foliar diseases in Beijing municipality of China. J Gen Plant Pathol. 82, 29-32.
    CrossRef
  53. Zur, G, Shimoni, E, Hallerman, E, and Kashi, Y (2002). Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay. J Food Prot. 65, 1433-1440.
    Pubmed CrossRef


December 2017, 33 (6)