search for




 

Loop-mediated Isothermal Amplification assay for Detection of Candidatus Liberibacter Asiaticus, a Causal Agent of Citrus Huanglongbing
The Plant Pathology Journal 2018;34:499-505
Published online December 1, 2018
© 2018 The Korean Society of Plant Pathology.

Cheol Woo Choi1, Jae Wook Hyun1,* , Rok Yeon Hwang1, and Charles A Powell2

1Citrus Research Institute, National Institute of Horticultural and Herbal Science, R.D.A. Jeju 63607, Korea, 2University of Florida, Institute of Food and Agricultural Sciences, Indian River Research and Education Center, 2199 South Rock Road, Fort Pierce, FL 34945, USA
Correspondence to: *Corresponding author: Phone) +82-64-730-4109, FAX) +82-64-733-9564, E-mail) hyunjaewook@korea.kr
Received October 12, 2018; Revised November 14, 2018; Accepted November 14, 2018.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Huanglongbing (HLB, Citrus greening disease) is one of the most devastating diseases that threaten citrus production worldwide. Although HLB presents systemically, low titer and uneven distribution of these bacteria within infected plants can make reliable detection difficult. It was known loop-mediated isothermal amplification (LAMP) method has the advantages of being highly specific, rapid, efficient, and laborsaving for detection of plant pathogens. We developed a new LAMP method targeting gene contained tandem repeat for more rapid and sensitive detection of Candidatus Liberibacter asiaticus (CLas), putative causal agent of the citrus huanglongbing. This new LAMP method was 10 folds more sensitive than conventional PCR in detecting the HLB pathogen and similar to that of real-time PCR in visual detection assay by adding SYBR Green I to mixture and 1% agarose gel electrophoresis. Positive reactions were achieved in reaction temperature 57, 60 and 62°C but not 65°C. Although this LAMP method was not more sensitive than real-time PCR, it does not require a thermocycler for amplification or agarose gel electrophoresis for resolution. Thus, we expect that this LAMP method shows strong promise as a reliable, rapid, and cost-effective method of detecting the CLas in citrus and can be applied for rapid diagnosis is needed.

Keywords : Citrus, detection, huanglongbing (HLB), loop-mediated isothermal amplification (LAMP)
Materials and Methods

Plant materials and genomic DNA extraction

Diseased leaves were collected from HLB infected grapefruit trees in the Indian River Research and Education Center (IRREC, Fort Pierce, FL) and healthy grapefruit leaves were sampled in IRREC Green house.

Total genomic DNA was extracted using a modified method of the Qiagen DNeasy Plant mini kit protocol (Qiagen, Germantown MD) reported previously (Hoffman et al., 2013). Two hundred milligrams of finely chopped midribs from leaf samples were put in a sterile 2 ml tube with silicone-carbide shards and, 2.3-mm chrome-steel beads, then then 800 ul AP1 extraction buffer and 80 ul of 20% SDS were added. Samples were homogenized with a Fast Prep-24 homogenizer (MP Biomedical, Solon, OH) at a speed of 6.5 for 100s. Eight microliters of RNase A was added and samples were incubated for 30 min at 65°C. Then 400 μl of AP2 buffer was added and samples were put on ice for 5 min. All subsequent processes were the same as the standard protocol. DNA samples were eluted in 100 ul of elution buffer and stored at −30°C.

Primer design for LAMP

Whole genome sequences of CLas strains, psy62, gxpsy and Ishi-1 have been completed (Duan et al., 2009; Lin et al., 2013; Katoh et al., 2014), but the LasAI and LasAII genes sequences of CLas isolates from Florida, China, Thailand, Philippines, India and Brazil, have also been reported previously (Puttamuk, 2014). For effective detection of CLas pathogens including these isolates, the LasAI gene sequences of these isolates were collected from the National Center for Biotechnology Information, aligned using Bio-Edit software, and it was determined that an area consisting of 269 bp from the start codon was highly conserved among these isolates (Fig. 1). A set of CLas-specific LAMP primers, F3, B3, FIP and BIP was designed based on this 269 bp length using PrimerExplorer software (http://primerexplorer.jp/e) (Table 1).

LAMP reaction

LAMP reaction mixtures prepared in a final volume of 20 μl containing 1 μl template DNA, 2.0 μM of FIP and BIP primers, 0.5 μM F3 and B3 primers, 1 mM of dNTPs, 8 U of Bst DNA polymerase (New England Biolabs, Ipswich, MA, USA), 1× ThermoPol reaction buffer (20 mM Tris-HCl, 10 mM KCl, 2 mM of MgSO4, 10 mM (NH4)2SO4, 0.1% Triton X-100, pH 8.8). After pretreating for 10 min at 95°C and 1 min at 4°C, the reaction mixtures were reacted for 1hour at four different reaction temperatures (57, 60, 62 and 65°C) and terminated for 5 min at 85°C.

Detection of LAMP products

After completion of the reaction, the LAMP amplification results were analyzed visually by adding 2 μl of a 1:10 dilution of SYBR Green I (10,000x, Invitrogen, Grand Island, NY, USA) and reactions that turned green were scored as positive and those that remained brown were scored as negative. Additionally, the amplified LAMP products were also analyzed by 1% agarose gel electrophoresis, stained with ethidium bromide and then photographed under a UV light using Gel Doc XR+ Gel Documentation System (Bio-rad Labolatories, Inc. Herules, CA).

Sequence analysis of LAMP product

For sequence analysis of LAMP products, to confirm reaction, the lowest band (Fig. 3A) from the LAMP reaction was eluted from a 4% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), and then cloned and transformed using the Topo TA Cloning Kit (Invitrogen, Carlsbad, CA). The plasmid was extracted using QIAprep Spin Miniprep Kit (Qiagen) and sequenced.

Comparison analysis of sensitivity of conventional PCR, real-time PCR and LAMP

Because CLas cannot be cultured, purified and quantified genomic DNA of CLas was not available for use as a positive control for real time PCR. Therefore we chose to use DNA extracted from CLas infected grapefruit leaves confirmed by real-time PCR to target tandem-repeats of CLas prophage genes (LasAI and LasAII), ct value was 22.8 in preliminary test. To compare detection sensitivity among conventional PCR, real-time PCR and LAMP, the DNA was serially diluted up to 10−6 and then used as template to evaluate detection limit of conventional PCR, real-time PCR and LAMP.

Conventional PCR

For conventional PCR, the F3/B3 primers listed in Table 1 were chosen. The PCR was performed in a final volume of 20 μl of reaction mixture containing 1 μl template DNA, 2.5 U DNA Taq DNA polymerase (Invitrogen), 1.0 μM of forward and reverse primers, 0.2 mM dNTP, 1 x PCR buffer (20 mM Tris-HCl, pH 8.4 and 50 mM KCl) and 1.5 mM MgCl2. PCR reactions were carried out as follows; pre-denaturation for 3 min at 95°C, 40 cycles of denaturation for 30 sec at 95°C, annealing for 30 sec at 60°C, extension for 30 sec at 72°C, and final extension for 5 min at 72°C. The PCR products were separated by electrophoresis in 1% agarose gel, stained with ethidium bromide and then photographed under UV light using a Gel Doc XR+ Gel Documentation System (Bio-rad Labolatories, Inc. Hercules, CA)

Real-time PCR

Additionally, a real-time PCR assay targeting the tandem repeat in LasAI gene of CLas was also conducted using primers and probe listed in Table 1, as previously studied (Zhou et al., 2011). The real-time PCR was performed on a CFX96 Touch Real-Time PCR Detection System (Bio-rad Labolatories, Inc. Hercules, CA) and used in a final volume of 20 μl of reaction mixture containing 2 μl template DNA, 1x real-time PCR probe master mix without ROX (GeneSee Scientific, CA, USA), 7 mM MgCl2, 250 nM forward/reverse primers, and 250 nM Taqman probe. The real-time PCR reaction included denaturation for 10 min at 95°C, and was followed by 40 cycles of 15s at 95°C and then 60°C for 30s.

Results

Evaluation of optimal reaction conditions for LAMP

In visual detection assay by adding 2 μl of 1:10 diluted SYBR Green I to mixture, the solution’s color turned green color at 57, 60 and 62°C reaction temperatures in HLB-infected plants as positive reaction while brown color remained at 65°C in HLB-infected plant, healthy plant and negative control as negative reactions (Fig. 2A). When analyzed by agarose gel electrophoresis, ladder-like bands were produced as positive LAMP reactions at 57, 60, and 62°C reaction temperatures in template DNA of HLB-infected plants but not at 65°C in HLB-infected plant, healthy plant and negative control (distilled water) (Fig. 2B).

Sequence analysis of LAMP product

To confirm whether LAMP products from reactions using HLB-infected DNA templates were specifically amplified, the lowest band visible when the LAMP product was run on a 4% agarose gel was cloned, sequenced and compared to the sequence of HLB strain psy62. As a result, the cloned DNA fragment was 182 bp, and the sequences were consistent with those of isolate psy62, within the targeted region of the LasAI gene except for a single mutation found at the 50th base of product (Fig. 3B).

Comparison sensitivity between conventional PCR, real-time PCR and LAMP

Detection sensitivities were compared by evaluation of detection limit by using conventional PCR, real-time PCR and LAMP assay. Specific amplified bands were observed at up to 10−2 dilution in conventional PCR assay. In LAMP, ladder–like bands by 1% agarose gel electrophoresis and green color by adding SYBR green dye were detected at up to 10−3 dilution (Fig. 4). The detection limit of the real-time PCR was at up to 10−3 dilution (Fig. 4D). Detection sensitivity of LAMP was 10 times higher than that of conventional PCR and was same as the sensitivity of real-time PCR.

Discussion

Accurate detection of citrus the HLB-associated bacterium can be challenging because of their low titers and uneven distribution within the infected plants (Li et al., 2009; Tatineni et al., 2008; Teixeira et al., 2008). Current real-time PCR methods target LasAI gene of CLas prophage genes (Morgan et al., 2012). The LasAI gene contained 12 nearly identical tandem repeat (NITRs) 132 bp in length and 4 partial repeats (Puttamuk et al., 2014). When compared with conventional 16S rDNA-based real-time PCR, targeting the repeat sequence reduced the relative detectable threshold by approximately 9 and 3 real-time PCR cycles for LasAI gene (Morgan et al., 2012).

Typical HLB leaf symptoms of citrus trees are very similar to those of micro-element deficiencies, such as zinc, iron and boron, it is difficult to diagnose the disease only the naked eye. Moreover, once infected, it takes more than a year to develop HLB symptoms on trees. Therefore to prevent the spread of HLB, we need a rapid and accurate diagnostic method that can detect the pathogen with low-titer in citrus early in the infection process. Recently, LAMP method is using to detect various plant pathogens including CLas for the advantages of being highly specific, rapid, efficient, and laborsaving. LAMP was developed to detect CLas targeting three copy 16S rDNA and CLIBASIA_ 05175 [GenBank: ACT57606.1] by Okuda et al. (2005) and Rigano et al. (2014), respectively. In this study, we developed LAMP method targeting LasAI gene contained 12 nearly identical tandem repeat for more rapid and sensitive detection of CLas than other methods. Positive results were recorded only for LAMP reactions where HLB-infected samples were used as template both by visual observation of color change within the reaction tubes and by the presence of DNA bands on agarose gels, and sequence analysis of LAMP products were consistent with those of HLB strain psy62, except for a single mutation at the 50th base of the amplicon. It is indicated these LAMP primers used in this study were specific to detect CLas. Though three species, CLas, Clam and CLaf, are associated with HLB, these LAMP primers developed to detect only CLas might be not specifically detect other species, Clam and CLaf.

This new LAMP method was 10 fold more sensitive than conventional PCR in detection of CLas pathogen and similar to that of real-time PCR. The reaction mixtures were reacted at four different reaction temperatures for determination of optimal reaction conditions for LAMP. Positive reactions were achieved in reaction temperature 57, 60 and 62°C but not 65°C. By this result, we recommend 62°C of reaction temperature for this LAMP method.

The LAMP method requires no expensive equipment unlike other PCR methods and its product can be amplified using a single constant temperature. Thus, we expect that this LAMP method shows strong promise as a reliable, rapid, and cost-effective method of detecting the CLas pathogen in citrus and can be applied where rapid diagnosis is needed like such as in the field.

Figures
Fig. 1. Alignment of partial of LasAI sequences of isolates from Florida, China, Thailand, Philippines India and Brazil, and primers designed for HLB loop-mediated isothermal amplification (LAMP). Length of 269 bp from start codon was used for primer design for LAMP PCR. Black arrows are indicated as primer target sequences and extension directions. The FIP and BIP primers consist of F1c plus F2 and B1c plus B2, respectively.
Fig. 2. Loop-mediated isothermal amplification (LAMP) for specific detection of ‘Candidatus Liberibacter asiaticus’ using the primer set from the prophage gene, LasAI in HLB-infected leaves of grapefruit according to reaction temperatures (57, 60, 62 and 65°C). condition test for HLB detection. (A) Visual detection under normal light by adding SYBR Green I dye. (B) Electrophoresis analysis on 1% agarose gel. Lanes 1–4; HLB-infected grapefruit leaves, lanes 5–8; healthy grapefruit leaves, lanes 9–11; distilled water, lane M; 100 bp DNA ladder (NEB New England Biolabs, cat# N3231S).
Fig. 3. Confirmation of loop-mediated isothermal amplification (LAMP) product sequence. (A) Electrophoresis analysis of LAMP products on 4% agarose gel. Lane M, 100 bp DNA marker. The amplified product of red square was eluted for sequence analysis. (B) Result of LAMP product sequence. The arrows were indicated as FIP and BIP primers and extension direction and, the black lines; as region of F1c and B1c primers, the red square; F3 and B3 primers for target region in LasAI gene, respectively.
Fig. 4. Sensitivity of loop-mediated isothermal amplification (LAMP), conventional PCR and real-time PCR for detecting HLB. (A) Visual examination of LAMP products by adding SYBR Green I dye. (B) Electrophoresis analysis of LAMP products on 1% agarose gel. (C) Electrophoresis analysis of conventional PCR products on 1% agarose gel. (D) Sensitivity of real-time PCR for detecting HLB using primers (LJ900p, LJ900r)/probe (LJ900p) listed in . Tube and lane 1–8, and template DNA for real-time PCR; serially diluted genomic DNA (1, 10−1, 10−2, 10−3, 10−4, 10−5, 10−6) and distilled water as negative control, respectively, M; 100 bp DNA ladder.
Tables

Sequence of primers/probe used in this study

TargetName1Sequence (5′-3′)LengthReference
LasAIF3GATCAAAGTTTGTCATTCCTTG22In this study
B3TCACCTTCGAAAATACGGAT20
F2ATTAAAGATCCAAGTAGGATTCATG25
F1cCTAGTTCTTGAACTCTTCCATCGG24
B2AAAATCCCCTTCTCTATTGTTG22
B1cCCAAGATTTTGATGTCGATGGGT23
FIPCTAGTTCTTGAACTCTTCCATCGG-ATTAAAGATCCAAGTAGGATTCATG49
BIPCCAAGATTTTGATGTCGATGGGT-AAAATCCCCTTCTCTATTGTTG45

LJ900fGCCGTTTTAACACAAAAGATGAATATC27Zhou et al. (2011)
LJ900rATAAATCAATTTGTTCTAGTTTACGAC27
LJ900pACATCTTTCGTTTGAGTAGCTAGATCATTGA31

1The FIP and BIP primers consist of F1c plus F2 and B1c plus B2, respectively.

References
  1. Bové, JM (2006). Huanglongbing: A destructive, newly-emerging, century-old disease of citrus. J Plant Pathol. 88, 7-37.
  2. CABI (2018). Invasive species compendium: citrus huanglongbing (greening) disease.URLhttps://www.cabi.org/isc/datasheet/16567 (15 November2018)
  3. Duan, Y, Zhou, L, Hall, DG, Li, W, Doddapaneni, H, Lin, H, Liu, L, Vahling, CM, Gabriel, DW, Williams, KP, Dickerman, A, Sun, Y, and Gottwald, T (2009). Complete genome sequence of citrus Huanglongbing bacterium, ‘Candidatus Liberibacter asiaticus’ obtained through metagenomics. Mol Plant-Microbe Interact. 22, 1011-1020.
    CrossRef
  4. Etxeberria, E, Gonzalez, P, Achor, D, and Albrigo, G (2009). Anatomical distribution of abnormally high levels of starch in HLB-affected Valencia orange trees. Physiol Mol Plant Pathol. 74, 76-83.
    CrossRef
  5. Fan, J, Chen, C, Achor, DS, Brlansky, RH, Li, ZG, and Gmitter, FG (2013). Differential anatomical responses of tolerant and susceptible citrus species to the infection of ‘Candidatus Liberibacter asiaticus’. Physiol Mol Plant Pathol. 83, 69-74.
    CrossRef
  6. Gottwald, TR (2010). Current epidemiological understanding of citrus Huanglongbing. Annu Rev Phytopathol. 48, 119-139.
    CrossRef
  7. Hoffman, MT, Doud, MS, Williams, L, Zhang, MQ, Ding, F, Stover, E, Hall, DG, Zhang, S, Jones, L, Gooch, M, Fleites, L, Dixon, WN, Gabriel, D, and Duan, YP (2013). Heat treatment eliminates ‘Candidatus Liberibacter asiaticus’ from infected citrus trees under controlled conditions. Phytopathology. 103, 15-22.
    CrossRef
  8. Jagoueix, S, Bové, JM, and Garnier, M (1996). PCR detection of the two ‘Candidatus’ Liberibacter species associated with greening disease of citrus. Mol Cell Probes. 10, 43-50.
    Pubmed CrossRef
  9. Katoh, H, Miyata, S, Inoue, H, and Iwanami, T (2014). Unique features of a Japanese ‘Candidatus Liberibacter asiaticus’ strain revealed by whole genome sequencing. PLoS ONE. 9, e106109.
    CrossRef
  10. Kim, JS, and Wang, N (2009). Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR. BMC Res Notes. 2, 37.
    Pubmed KoreaMed CrossRef
  11. Koh, EJ, Zhou, L, Williams, DS, Park, J, Ding, N, Duan, YP, and Kang, BH (2012). Callose deposition in the phloem plasmodesmata and inhibition of phloem transport in citrus leaves infected with “Candidatus Liberibacter asiaticus”. Protoplasma. 249, 687-97.
    CrossRef
  12. Lee, S, Kim, JH, Choi, JY, and Jang, WC (2015). Loop-mediated isothermal amplification assay to rapidly detect Wheat Streak Mosaic Virus in quarantined plants. Plant Pathol J. 31, 438-440.
    Pubmed KoreaMed CrossRef
  13. Li, W, Hartung, JS, and Levy, L (2006). Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J Microbiol Methods. 66, 104-115.
    Pubmed CrossRef
  14. Li, W, Levy, L, and Hartung, JS (2009). Quantitative distribution of ‘Candidatus Liberibacter asiaticus’ in citrus plants with citrus Huanglongbing. Phytopathology. 99, 139-144.
    Pubmed CrossRef
  15. Lin, H, Chen, C, Doddapaneni, H, Duan, YP, Civerolo, E, Bai, X, and Zhao, X (2010). A new diagnostic system for ultra-sensitive and specific detection and quantification of Candidatus Liberibacter asiaticus, the bacterium associated with citrus Huanglongbing. J Microbiol Methods. 81, 17-25.
    Pubmed CrossRef
  16. Lin, H, Han, CS, Liu, B, Lou, B, Bai, X, Deng, C, Civerolo, E, and Gupta, G (2013). Complete genome sequence of a Chinese strain of ‘Candidatus Liberibacter asiaticus’. Genome Announc. 1, e00184-13.
    KoreaMed CrossRef
  17. Morgan, JK, Zhou, LJ, Li, W, Shatters, RG, Keremane, M, and Duan, YP (2012). Improved real-time PCR detection of ‘Candidatus Liberibacter asiaticus’ from citrus and psyllid hosts by targeting the intragenic tandem-repeats of its prophage genes. Mol Cell Probes. 26, 90-98.
    Pubmed CrossRef
  18. Nagamine, K, Hase, T, and Notomi, T (2002). Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 16, 223-229.
    Pubmed CrossRef
  19. Nageswara-Rao, M, Irey, M, Garnsey, SM, and Gowda, S (2013). Candidate gene makers for Candidatus Liberibacter asiaticus for detecting citrus greening disease. J Biosci. 38, 229-237.
    Pubmed CrossRef
  20. Okuda, M, Matsumoto, M, Tanaka, Y, Subandiyah, S, and Iwanami, T (2005). Characterization of the tufB-secE-nusG-rplKAJL-rpoB gene cluster of the citrus greening organism and detection by loop-mediated isothermal amplification. Plant Dis. 89, 705-711.
    CrossRef
  21. Pietersen, G, Arrebola, E, Breytenbach, JHJ, Korsten, L, le Rox, HF, la Grange, H, Lopes, SA, Meyer, JB, Pretorius, MC, Schwerdtfeger, M, van Vuuren, SP, and Yamamoto, P (2010). A survey for ‘Candidatus Liberibacter’ species in South Africa confirms the presence of only ‘Ca. L. africanus’ in commercial citrus. Plant Dis. 94, 244-249.
    CrossRef
  22. Puttamuk, T, Zhou, L, Thaveechai, N, Zhang, S, Armstrong, CM, and Duan, YP (2014). Genetic diversity of Candidatus Liberibacter asiaticus based on two hypervariable effector genes in Thailand. PLoS ONE. 9, e112968.
    Pubmed KoreaMed CrossRef
  23. Ravindran, A, Levy, J, Pierson, E, and Gross, DC (2012). Development of a loop-mediated isothermal amplification procedure as a sensitive and rapid method for detection of ‘Candidatus Liberibacter solanacearum’ in potatoes and psyllids. Phytopathology. 102, 899-907.
    Pubmed CrossRef
  24. Rigano, LA, Malamud, F, Orce, IG, Filippone, MP, Marano, MR, do Amaral, AM, Castagnaro, AP, and Vojnov, AA (2014). Rapid and sensitive detection of Candidatus Liberibacter asiaticus by loop mediated isothermal amplification combined with a lateral flowdipstick. BMC Microbiol. 14, 86.
    CrossRef
  25. Song, ZQ, Cheng, JE, Cheng, FX, Zhang, DY, and Liu, Y (2017). Development and evaluation of loop-mediated isothermal amplification assay for rapid detection of Tylenchulus semipenetrans using DNA extracted from soil. Plant Pathol J. 33, 184-192.
    Pubmed KoreaMed CrossRef
  26. Takushi, T, Toyozato, T, Kawano, S, Taba, S, Taba, K, Ooshiro, A, Numazawa, M, and Tokeshi, M (2007). Scratch method for simple, rapid diagnosis of citrus huanglongbing using iodine to detect high accumulation of starch in the citrus leaves. Jpn J Phytopathol. 73, 3-8.
    CrossRef
  27. Tatineni, S, Sagaram, US, Gowda, S, Robertson, CJ, Dawson, WO, Iwanami, T, and Wang, N (2008). In planta distribution of ‘Candidatus Liberibacter asiaticus’ as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology. 98, 592-599.
    Pubmed CrossRef
  28. Teixeira, DC, Danet, JL, Eveillard, S, Martins, EC, de Jesus, WC, Yamamoto, PT, Lopes, SA, Bassanezi, RB, Ayres, AJ, Saillard, C, and Bové, JM (2005). Citrus huanglongbing in Sao Paulo State, Brazil: PCR detection of the ‘Candidatus’ Liberibacter species associated with the disease. Mol Cell Probes. 19, 173-179.
    CrossRef
  29. Teixeira, DC, Saillard, C, Couture, C, Martins, EC, Wulff, NA, Eveillard-Jagoueix, S, Yamamoto, PT, Ayres, AJ, and Bové, JM (2008). Distribution and quantification of Candidatus Liberibacter americanus, agent of huanglongbing disease of citrus in Sao Paulo State, Brazil, in leaves of an affected sweet orange tree as determined by PCR. Mol Cell Probes. 22, 139-150.
    Pubmed CrossRef
  30. Temple, TN, and Johnson, KB (2011). Evaluation of loop-mediated isothermal amplification for rapid detection of Erwinia amylovora on pear and apple fruit flowers. Plant Dis. 95, 423-430.
    CrossRef
  31. Villechanoux, S, Garnier, M, and Bové, JM (1990). Purification of the bacterium-like organism associated with greening disease of citrus by immunoaffinity chromatography and monoclonal antibodies. Curr Mocrobiol. 21, 175-180.
    CrossRef
  32. Zhou, L, Powell, CA, Hoffman, MT, Li, W, Fan, G, Liu, B, Lin, H, and Duan, YP (2011). Diversity and plasticity of the intracellular plant pathogen and insect symbiont “Candidatus Liberibacter asiaticus” as revealed by hypervariable prophage genes with intragenic tandem repeats. Appl Environ Microbiol. 77, 6663-6673.
    Pubmed KoreaMed CrossRef


April 2019, 35 (2)
  • DOAJ
  • ORCID