search for




 

Race- and Isolate-specific Molecular Marker Development through Genome-Realignment Enables Detection of Korean Plasmodiophora brassicae Isolates, Causal agents of Clubroot Disease
The Plant Pathology Journal 2018;34:506-513
Published online December 1, 2018
© 2018 The Korean Society of Plant Pathology.

Ji-Yun Jeong1,†, Arif Hasan Khan Robin1,2,†, Sathishkumar Natarajan1,†, Rawnak Laila1, Hoy-Taek Kim1, Jong-In Park1,*, and Ill-Sup Nou1,*

1Department of Horticulture, Sunchon National University, Suncheon 57922, Korea, 2Department of Genetics and Plant Breeding, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh
Correspondence to: *Corresponding author: Jong-In Park, Phone) +82-61-750-3241, FAX) +82-61-750-3208, E-mail) jipark@sunchon.ac.kr, Ill-Sup Nou, Phone) +82-61-750-3249, FAX) +82-61-750-3208, E-mail) nis@sunchon.ac.kr
Received December 20, 2017; Revised August 26, 2018; Accepted August 30, 2018.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Clubroot is one of the most economically important diseases of the Brassicaceae family. Clubroot disease is caused by the obligate parasite Plasmodiophora brassicae, which is difficult to study because it is non-culturable in the laboratory and its races are genetically variable worldwide. In Korea, there are at least five races that belongs to four pathotype groups. A recent study conducted in Korea attempted to develop molecular markers based on ribosomal DNA polymorphism to detect P. brassicae isolates, but none of those markers was either race-specific or pathotype-specific. Our current study aimed to develop race- and isolate-specific markers by exploiting genomic sequence variations. A total of 119 markers were developed based on unique variation exists in genomic sequences of each of the races. Only 12 markers were able to detect P. brassicae strains of each isolate or race. Ycheon14 markers was specific to isolates of race 2, Yeoncheon and Hoengseong. Ycheon9 and Ycheon10 markers were specific to Yeoncheon isolate (race 2, pathotype 3), ZJ1-3, ZJ1-4 and ZJ1-5 markers were specific to Haenam2 (race 4) isolate, ZJ1-35, ZJ1-40, ZJ1-41 and ZJ1-49 markers were specific to Hoengseong isolate and ZJ1-56 and ZJ1-64 markers were specific to Pyeongchang isolate (race 4, pathotype 3). The PCR-based sequence characterized amplified region (SCAR) markers developed in this study are able to detect five Korean isolates of P. brassicae. These markers can be utilized in identifying four Korean P. brassicae isolates from different regions. Additional effort is required to develop race- and isolate-specific markers for the remaining Korean isolates.

Keywords : clubroot, isolate-specific markers, Plasmodiophora bassicae, SCAR markers, sequence comparison
Materials and Methods

Retrieval and alignment of P. brassicae genomic DNA sequences

Genomic sequences of P. brassicae isolates e3 and ZJ-1 were retrieved from NCBI (Genbank accession numbers GCA_001049375.1 and GCA_002093825.1, respectively). The sizes of the e3 and ZJ-1 genomes were 24.0508 and 24.8311 Mb, respectively (Table 1). We recently sequenced partial genomic DNA sequences of four additional P. brassicae isolates (21 Mb each): Daejeon, Gangneung 1, Haenam-2, and Yeoncheon (SRA accession: SRP150814). Genomic sequences of these four isolates were compared to identify variable nucleotide positions. These six sequences were aligned using the “Align with progressiveMauve” approach in Mauve (v. 2.4.0) (Darling et al., 2010) and visualized in Geneious (v. 11.0.3, Kearse et al., 2012). This comparison identified variable regions among these isolates that were used to develop isolate-specific primers (Fig. 1).

Design of isolate-specific primers

Isolate-specific primers were designed using Primer3 software (Koressaar and Remm, 2007; Untergasser et al., 2012). Primer specificity was tested following Robin et al. (2016). A total of 115 primers were designed (Table 2, Supplementary Table 1).

Collection of P. brassicae infected isolates

We infected Chinese cabbage variety Bullam-3-ho with 11 previously collected P. brassicae isolates: Gangneung (1 and 2), Yeoncheon, Daejeon, Haenam (1 and 2), Seosan, Pyeongchang, Hoengseong, Geumsan, and Goesan (Jo et al., 2016; Kim et al., 2016; Lail et al., 2017). Fresh clubroot galls were collected and washed for isolation of P. brassicae genomic DNA.

P. brassicae DNA isolation

DNA was isolated following the method of Laila et al. (2017). Galls from all isolates were cleaned in running tap water and the outer surface was peeled off. The cleaned galls were then surface-sterilized with 70% (v/v) ethanol for 60 s. Approximately 100 mg of gall tissue was collected in a 1.5 ml Eppendorf tube. Individual gall samples were homogenized in 1.5 ml cetrimethyl ammonium bromide (CTAB) (20 g CTAB, 12.11 g Tris, 81.8 g NaCl, and 7.4 g·l−1 disodium-ethylene diamine tetraacetic acid (EDTA); pH 8.0) solution with 30 μl proteinase K (20 mg·l−1, GeneScan) and 30 μl DNaseI (Sigma, St. Louis, MO, USA). The homogenized galls were then incubated at 60°C for 2 h. DNaseI eliminates Brassica rapa host DNA as much as possible (Buhariwalla and Mithen, 1995; Buhariwalla et al., 1995; Manzanares-Dauleux et al., 2001) as it is believed that DNA of P. brassicae become integrated with host DNA during infection process (Bryngelsson et al., 1988). The homogenized suspensions were then centrifuged at 10,000 × g for 5 min. SFG1 Buffer (400 μl) and RNase A (4 μl, Omega Bio-Tek) were mixed with the supernatant in a 1.5 ml tube and vortexed at a maximum speed. The EZNA SP Fungal DNA Miniprep Kit (Omega Bio-Tek, Doraville, GA, USA) was used to extract P. brassicae DNA, following the manufacturer’s protocol. DNA was stored at −20°C after its quantity and quality were assessed with a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Extraction of DNA from host control plant

A Japanese cabbage variety (Akimeki) that is resistant to clubroot disease was used as a control to assess the specificity of P. brassicae host genomic DNA. Host genomic DNA was extracted with the Qiagen DNeasy Minikit following the manufacturer’s instructions (Qiagen, Hilden, Germany).

PCR amplification and agarose gel electrophoresis

The Phusion High-Fidelity DNA PCR kit (New England Biolabs, Inc., Ipswich, MA, USA) was used to amplify genomic DNA of 11 P. brassicae isolates. Each 50 μl PCR reaction included 1 μl gDNA, 2 μl of each primer, 0.6 μl Phusion DNA Polymerase, 10 μl Phusion HF Buffer, 4 μL dNTPs, and 29.4 μl sterile distilled water (see Table 2 for primer sequences). Reactions were pre-incubated for 5 min at 95°C followed by 35 cycles of amplification at 95°C for 30 s, 58°C for 30 s and 72°C for 45 s in an Eppendorf thermal cycler (Eppendorf AG, Hamburg, Germany). The melting of the mixture was carried out at 72°C for 5 min. PCR products were visualized on a 1.2% agarose gel with 1 × TBE buffer.

Isolate-specific marker selection

Race-specific markers were selected based on the presence and absence of amplified bands. When a particular primer pair amplified only one isolate and host DNA, the amplified region was considered an isolate-specific marker.

Results and Discussion

Sequence comparison

By comparing genomic DNA sequences, we have found several regions that vary among P. brassicae isolates. There e3 and ZJ-1 isolates had 59.2% and 59.0% GC content, respectively. Notable variation in %GC content was also evident in four Korean P. brassicae isolates, ranging from 56.0–59.0 (Fig. 1). We used the e3 isolate as a reference genome for the purpose of genome comparisons.

Yeoncheon-isolate specific marker

Out of 117 designed markers, 20 primers were e3-specific, 61 primers were ZJ1-specific, two primers were Daejeon-specific, 17 primers were Yeoncheon-specific, six primers were Haenam2-specific, and 11 primers were Gangneung1-specific. Only 12 markers amplified genomic DNA of either a single isolate or two isolates of the same race. The remaining 107 marker sets were non-specific (Supplementary Fig. 1). Two Yeoncheon-specific primers, Ycheon9 and Ycheon10, produced only a single amplicon (Fig. 2), indicating that these sequences characterized amplified region (SCAR) markers might enable specific detection of the Yeoncheon isolate. The primer pair Ycheon14 amplified the targeted region in both the Yeoncheon and Hoengseong isolates (Fig. 2). Since both of these isolates belong to race 2, this marker may be broadly useful in detecting race 2 P. brassicae isolates. The difference in isolate specificity of markers Ycheon9 and Ycheon10 within race 2 might be due to sequence variation between the isolates Yeoncheon and Hoengseong.

Haenam2-isolate specific markers

Three primer pairs that were designed based on the genomic sequence of the Chinese isolate ZJI (ZJI 3, ZJI 4 and ZJI 5) produced a single amplicon from the Haenam2 isolate (Fig. 3). These three SCAR markers failed to amplify the target region in the other 10 isolates and the control host plant (Fig. 3). It is possible that these markers also amplify the Chinese P. brassicae isolate ZJI, but we did not test this possibility.

Hoengseong-isolate specific markers

Four primer pairs (ZJI 35, ZJI 40, ZJI 41 and ZJI 49) amplified the target region in the Hoengseong isolate only (Fig. 4), indicating that these markers can specifically detect this isolate. Amplification of the Hoengseong isolate with ZJI-specific SCAR markers indicates that the specific primer sequence used is absent in the other P. brassicae isolates examined in this study.

Pyeongchang-isolate specific markers

Two other markers (ZJ1 56 and ZJ1 61) amplified the target region in the Pyeongchang-isolate only (Fig. 5). The amplicons were of expected size. These two SCAR markers can be utilized in identifying the Korean P. brassicae isolate Pyeongchang. This result further indicated that ZJ1 isolate has genome similarity with only Pyeongchang-isolate at the primer binding site.

Race- and isolate-specific markers and their potential applications

In this study, we developed 12 SCAR markers that identify particular Korean isolates of the clubroot pathogen P. brassicae. Eleven of these markers were specific to four single isolates. Importantly, two Yeoncheon isolate-specific markers perfectly amplified only Yeoncheon isolate of Korea. These markers have the potential to specifically identify Yeoncheon-like isolates from Korean fields. Similarly, the other nine SCAR markers were specific to the Haenam2, Hoengseong, and Pyeongchang isolates. Because three Haenam2-specific markers, four Hoengseong-specific markers, and two Pyeongchang-specific markers were designed based on the genome sequence of the Chinese isolate ZJ1, we predict that these markers may also amplify this Chinese isolate, but we did not test this possibility. We therefore recommended that these markers be tested on all P. brassicae isolates worldwide to further test their specificity and potentially establish them as universal markers. One of the pre-existing limitation at the commencement of this study was lack of any race-specific and isolate-specific markers that can detect a particular P. brassicae isolate. The newly developed marker can efficiently detect four Korean P. brassicae and possibly one Chinese isolate based on genomic DNA sequence variation. Efforts are needed to develop markers to enable detect other Korean P. brassicae isolates.

Supplementary Information
Figures
Fig. 1. Alignment of whole genome sequences of Plasmodiophora brassicae. (A) Alignment of five isolates: the dotted rectangles in Yeoncheon and ZL1 indicate the regions where isolate-specific markers were targeted. (B) Identified Yeoncheon- and ZJ1-specific markers regions are highlighted by black arrows.
Fig. 2. Three markers specific to the Yeocheon (Ycheon 9 and Ycheon 10), Yeocheon and Hoengseong (Ycheon14) isolates of race 2. Akimeki is a control host. R, race; P, pathotype.
Fig. 3. Three markers showing specificity to the Haenam2 isolate of race 4 and pathotype 4. Akimeki, a Japanese Chinese cabbage cultivar, was a control host. R, race; P, pathotype.
Fig. 4. Four markers showing specificity to the Hoengseong isolate of race 2 and pathotype 1. Akimeki, a Japanese Chinese cabbage cultivar, was a control host. R, race; P, pathotype.
Fig. 5. Four markers showing specificity to the Pyeongchang isolate of race 4 and pathotype 3. Akimeki, a Japanese Chinese cabbage cultivar, was a control host. R, race; P, pathotype.
Tables

Plasmodiophora brassicae isolates used for comparing genome sequences. Sequences of e3 and ZJ-1 isolates were compared to four Korean isolates

IsolateSequenceRaceCountryGenome sizeReference
e3GenomeRace unknownSweden24.0508 MbSchwelm et al. (2015)
ZJ-1GenomeRace 1China24.8311 MbBi et al. (2016)
DaejeonWhole genome re-seqRace 5Korea21 Mb
Gangneung 1Whole genome re-seqRace 9Korea21 MbSRA accession: SRP150814
Haenam-2Whole genome re-seqRace 4Korea21 Mb
YeoncheonWhole genome re-seqRace 2Korea21 Mb

Forward and reverse primer sequences used to identify Korean Plasmodiophra brassicae isolates

Sequence No.Given primer nameForward sequenceReverse sequenceProduct Size (bp)Genomic positions

StartEnd
>LCB455.5Ycheon_9ACAGTGCGGGTAGTCTATACGACAGTGCGGGTAGTCTATACG13173569034374
>LCB460.5Ycheon_10TCGAACCAGAAACCGTGAACTTCGGCACATCCCCATACAT15894499843410
>LCB975.5Ycheon_14GGTATGATTGTACAGGTCGCCCACTTTCCGGCAAACTACGC145932471789
>LCB888.2ZJ1_3TGGACGAGGCTGACAATCTTCAAAAGCTCACAACGGTCGA1073224268223196
>LCB1098.2ZJ1_4GTCGGCGATCTGGAGAACTACACGACGAGCTTCATTCCAG10606662265563
>LCB1098.2ZJ1_5CACCAGTATTTCGCGCTTCAAGGTTTGATCCGCCTGTACA11186549764380
>LCB608.2ZJ1_35CTCCAACTTGAAAGGCAGAGGGATGCAACGAACGCTTTGAC5477611307
>LCB679.2.1ZJ1_40TGAATACGAACCGATGCTGCCGTACACAATGGTTCGGCTG517224996224480
>LCB679.2.2ZJ1_41CGGAGTTGAACGAGACTAGCGCATACCTAATTGAGCGCGT722222677222019
>LCB830.2ZJ1_49CTTCATCACTAGGCATGCGGAACGAATCAGTGCATGGACC485118258118742
>LCB975.2ZJ1_56GGTACCGGTTCTTCACGTTCGAGTGAACCCAGACCTGACA1450138164136715
>LCB1188.2ZJ1_61TTCACATCACGTTGCACAGGCCTCCACCGCGTTATCAGTA452806998807400
References
  1. Bryngelsson, T, Gustafsson, M, Gréen, B, and Lind, C (1988). Uptake of host DNA by the parasitic fungus Plasmodiophora brassicae. Physiol Mol Plant Pathol. 33, 163-171.
    CrossRef
  2. Buczacki, ST, Toxopeus, H, Mattusch, P, Johnston, TD, Dixon, GR, and Hobolth, LA (1975). Study of physiologic specialization in Plasmodiophora brassicae: Proposals for attempted rationalization through an international approach. Trans Br Mycol Soc. 65, 295-303.
    CrossRef
  3. Buhariwalla, H, and Mithen, R (1995). Cloning of a Brassica repetitive DNA element from resting spores of Plasmodiophora brassicae. Physiol Mol Plant Pathol. 47, 95-101.
    CrossRef
  4. Buhariwalla, H, Greaves, S, Magrath, R, and Mithen, R (1995). Development of specific PCR primers for the amplification of polymorphic DNA from the obligate root pathogenPlasmodiophora brassicae. Physiol Mol Plant Pathol. 47, 83-94.
    CrossRef
  5. Darling, AE, Mau, B, and Perna, NT (2010). progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. PloS One. 5, e11147.
    Pubmed KoreaMed CrossRef
  6. Dixon, GR (2009). The occurrence and economic impact of Plasmodiophora brassicae and clubroot disease. J Plant Growth Regul. 28, 194-202.
    CrossRef
  7. Faggian, R, and Strelkov, SE (2009). Detection and measurement of Plasmodiophora brassicae. J Plant Growth Regul. 28, 282-288.
    CrossRef
  8. Hatakeyama, K, Fujimura, M, Ishida, M, and Suzuki, T (2004). New classification method for Plasmodiophora brassicae field isolates in Japan based on resistance of F1 cultivars of Chinese cabbage (Brassica rapa L.) to clubroot. Breed Sci. 54, 197-201.
    CrossRef
  9. Ito, S, Maehara, T, Tanaka, S, Kameyaiwaki, M, Yano, S, and Kishi, F (1997). Cloning of a single-copy DNA sequence unique to Plasmodiophora brassicae. Physiol Mol Plant Pathol. 50, 289-300.
    CrossRef
  10. Ito, S, Maehara, T, Maruno, E, Tanaka, S, Kameya-Iwaki, M, and Kishi, F (2008). Development of a PCR-based assay for the detection of Plasmodiophora brassicae in soil. J Phytopathol. 147, 83-88.
    CrossRef
  11. Jo, E, Jang, K, Choi, Y, Ahn, K, and Choi, G (2016). Resistance of cabbage plants to isolates of Plasmodiophora brassicae. Korean J Hortic Sci Technol. 34, 442-452.
  12. Jo, SJ, Shim, SA, Jang, KS, Choi, YH, Kim, JC, and Choi, GJ (2011). Resistance of cultivars of Chinese cabbage to Plasmodiophora brassicae isolates of several races collected in Korea. Korean J Hortic Sci Technol. 29, 610-616.
  13. Karling, JS (1968). The Plasmodiophorales. New York, USA: Hafner Publishing Company, pp. 256
  14. Kearse, M, Moir, R, Wilson, A, Stones-Havas, S, Cheung, M, Sturrock, S, Buxton, S, Cooper, A, Markowitz, S, Duran, C, Thierer, T, Ashton, B, Mentjies, P, and Drummond, A (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 28, 1647-1649.
    Pubmed KoreaMed CrossRef
  15. Koressaar, T, and Remm, M (2007). Enhancements and modifications of primer design program Primer3. Bioinformatics. 23, 1289-1291.
    Pubmed CrossRef
  16. Kim, H, Jo, EJ, Choi, YH, Jang, KS, and Choi, GJ (2016). Pathotype classification of Plasmodiophora brassicae isolates using clubroot-resistant cultivars of Chinese cabbage. Plant Pathol J. 32, 423-430.
    Pubmed KoreaMed CrossRef
  17. Kim, WG, Moon, MH, Kim, JH, Choi, HW, and Hong, SK (2009). Occurrence of clubroot on pak-choi caused by Plasmodiophora brassicae. Mycobiology. 37, 69-71.
    Pubmed KoreaMed CrossRef
  18. Kuginuki, Y, Yoshikawa, H, and Hirai, M (1999). Variation in virulence of Plasmodiophora brassicae in Japan tested with club root resistant cultivars of Chinese cabbage (Brassica rapa L. ssp. pekinensis). Eur J Plant Pathol. 105, 327-332.
    CrossRef
  19. Laila, R 2018. Molecular investigations towards clubroot resistance and expression of wax biosynthesis genes in Brassicaceae family. Ph D thesis. Sunchon National University. Sunchon, Korea.
  20. Laila, R, Robin, AH, Yang, K, Choi, GJ, Park, JI, and Nou, IS (2017). Detection of ribosomal DNA sequence polymorphisms in the protist Plasmodiophora brassicae for the identification of geographical isolates. Int J Mol Sci. 18, 84.
    KoreaMed CrossRef
  21. Li, Y, Yuan, Y, Zhao, Y, Wei, X, Yao, Q, Jiang, W, Wang, Z, Yang, S, Zhang, X, and Tian, B (2017). Pathogen identification of clubroot disease in Chinese cabbage from Yuanyang county, Henan province. Mol Plant Breed. 8, 45-51.
  22. Li, Z, Niu, YZ, Wu, YC, and Guo, SX (2013). Research advances in clubroot disease. Southwest China J Agri Sci. 26, 1733-1737.
  23. Manzanares-Dauleux, MJ, Divaret, I, Baron, F, and Thomas, G (2001). Assessment of biological and molecular variability between and within field isolates of Plasmodiophora brassicae. Plant Pathol. 50, 165-173.
    CrossRef
  24. Nikolaev, SI, Berney, C, Fahrni, JF, Bolivar, I, Polet, S, Mylnikov, AP, Aleshin, VV, Petrov, NB, and Pawlowski, J (2004). The twilight of heliozoa and rise of Rhizaria, an emerging supergroup of amoeboid eukaryotes. Proc Natl Acad Sci USA. 101, 8066-8071.
    Pubmed KoreaMed CrossRef
  25. Robin, AH, Yi, GE, Laila, R, Yang, K, Park, JI, Kim, HR, and Nou, IS (2016). Expression profiling of glucosinolate biosynthetic genes in Brassica oleracea L. var. capitata inbred lines reveals their association with glucosinolate content. Molecules. 21, E787.
    Pubmed CrossRef
  26. Schwelm, A, Fogelqvist, J, Knaust, A, Jülke, S, Lilja, T, Bonilla-Rosso, G, Karlsson, M, Shevchenko, A, Dhandapani, V, Choi, SR, Kim, HG, Park, JY, Lim, YP, Ludwig-Müller, J, and Dixelius, C (2015). The Plasmodiophora brassicae genome reveals insights in its life cycle and ancestry of chitin synthases. Sci Rep. 5, 11153.
    Pubmed KoreaMed CrossRef
  27. Somé, A, Manzanares, MJ, Laurens, F, Baron, F, Thomas, G, and Rouxel, F (1996). Variation for virulence on Brassica napus L. amongst Plasmodiophora brassicae collections from France and derived single-spore isolates. Plant Pathol. 45, 432-439.
    CrossRef
  28. Tsushima, S (2000). Perspective of integrated pest management-a case study: clubroot disease of crucifers. J Pest Sci. 25, 296-299.
    CrossRef
  29. Untergasser, A, Cutcutache, I, Koressaar, T, Ye, J, Faircloth, BC, Remm, M, and Rozen, SG (2012). Primer3-new capabilities and interfaces. Nucleic Acids Res. 40, e115.
    CrossRef
  30. Voorrips, RE (1995). Plasmodiophora brassicae: aspects of pathogenesis and resistance in Brassica oleracea. Euphytica. 83, 139-146.
    CrossRef
  31. Wallenhammar, AC (1996). Prevalence of Plasmodiophora brassicae in a spring oilseed rape growing area in central Sweden and factors influencing soil infestation levels. Plant Pathol. 45, 710-719.
    CrossRef
  32. Wallenhammar, AC, and Arwidsson, O (2001). Detection of Plasmodiophora Brassicae by PCR in naturally infested soils. Eur J Plant Pathol. 107, 313-321.
    CrossRef
  33. Wang, J, Huang, Y, Hu, XL, Niu, YZ, Li, XL, and Liang, Y (2008). Study on symptom, yield loss of clubroot and modality of Plasmodiophora brassicae in rape. Chinese J Oil Crop Sci. 30, 112-115.
  34. Williams, PH (1966). A system for determination of races of Plasmodiophora brassicae that infect Cabbage and Rutabaga. Phytopathology. 56, 624-626.
  35. Yang, PW, Yang, QZ, Wang, Q, Li, JR, and Zeng, L (2002). PCR detection of Plasmodiophora brassicae causing cruciferae clubroot. J Yunnan Agric Univ. 17, 137-139.