search for




 

Rapid and Specific Detection of Apple stem grooving virus by Reverse Transcription-recombinase Polymerase Amplification
The Plant Pathology Journal 2018;34:575-579
Published online December 1, 2018
© 2018 The Korean Society of Plant Pathology.

Nam-Yeon Kim1, Jonghee Oh2, Su-Heon Lee2, Hongsup Kim3, Jae Sun Moon4, and Rae-Dong Jeong1,*

1Department of Applied Biology, Institute of Environmentally Friendly Agriculture, Chonnam National University, Gwangju 61185, Korea, 2School of Applied Biosciences, Kyungpook National University, Daegu 98411, Korea, 3Seed Testing & Research Center, Korea Seed & Variety Service, Gimcheon, Korea, 4Plant Genome Research Center, Korea Research Institute of Bioscience & Biotechnology, Daejeon, Korea
Correspondence to: *Corresponding author: Phone) +82-62-530-2075, FAX) +82-62-530-2069, E-mail) jraed2@jnu.ac.kr
Received June 18, 2018; Revised August 26, 2018; Accepted August 26, 2018.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Apple stem grooving virus (ASGV) is considered to cause the most economically important viral disease in pears in Korea. The current PCR-based methods used to diagnose ASGV are time-consuming in terms of target detection. In this study, a novel assay for specific ASGV detection that is based on reverse transcription-recombinase polymerase amplification is described. This assay has been shown to be reproducible and able to detect as little as 4.7 ng/μl of purified RNA obtained from an ASGV-infected plant. The major advantage of this assay is that the reaction for the target virus is completed in 1 min, and amplification only requires an incubation temperature of 42°C. This assay is a promising alternative method for pear breeding programs or virus-free certification laboratories.

Keywords : Apple stem grooving virus, molecular diagnosis, reverse transcription-recombinase polymerase amplification
Supplementary Information
Figures
Fig. 1. Primer position within the coat protein of Apple stem grooving virus (ASGV) and the detection of ASGV by RT-RPA. (A) Clustal W multiple sequence alignment was performed with Bio-edit using the sequence of Korea ASGV isolates with isolates from other countries. Unfilled boxes represent the primer regions used in this study. (B) RT-RPA amplification products of ASGV. M, DNA marker; lane 1, ASGV-infected tissues; lane 2, non-infected tissues control. Five independent reactions were performed, and similar results were obtained.
Fig. 2. Determination of optimal reaction time for ASGV diagnosis using RT-RPA. ASGV was amplified with RT-RPA for different time points and a clear DNA band of the expected size (143 bp) could be visualized by agarose gel electrophoresis. M, DNA marker; lanes 1–7, DNA products from reactions incubated for 1, 3, 5, 10, 15, 20, and 30 min, respectively.
Fig. 3. Sensitivity of RT-RPA. (A) The detection limit of the RT-RPA assay using total RNA isolated from pear leaves infected with ASGV. M, DNA marker; lanes 1–5, serial 10-fold dilutions of RNA (ranging from 47 ng/μl to 4.7 pg/μl). (B) The detection limit of the RT-PCR assay using total RNA isolated from pear leaves infected with ASGV. M, DNA marker; lanes 1–5, serial 10-fold dilution of RNA (ranging from 47 ng/μl to 4.7 pg/μl).
Fig. 4. Specificity of RT-RPA for ASGV. Total RNAs from the ASGV-, ACLSV-, and ASPV-infected tissues were all tested using RT-RPA. M, DNA marker; lane 1, ASGV-infected tissues; lane 2, ACLSV-infected tissues; lane 3, ASPV-infected tissues; lane 4, virus-free tissues; lane 5, no-template virus. Five independent reactions were performed with similar results observed for all five reactions.
Tables

Primers used in this study

VirusPrimersPrimer sequences (5′-3′)Size (bp)
ASGVASGV RPA 1FGTAGGAGTGTATCTCTGGAAGACTCACATAGACCC143
ASGV RPA 1RAAATATTTACAATAGTGATTGCAGAGAAGAAGGTA
References
  1. Adams, MJ, Candresse, T, Hammond, J, Kreuze, JF, Martelli, GP, Namba, S, Pearson, MN, Ryu, KH, Saldarelli, P, and Yoshikawa, N (2012). Family Betaflexiviridae. Virus taxonomy: Ninth report of the international committee on the taxonomy of viruses, King, AMG, Adams, MJ, Carstens, EB, and Lefkowitz, EJ, ed. Amsterdam, The Netherlands: Elsevier-Academic Press, pp. 920-941
  2. Cho, IS, Kim, DH, Kim, HR, Chung, BN, Cho, JD, and Choi, GS (2010). Occurrence of pome fruit viruses on pear trees (Pyrus pyrifolia) in Korea. Res Plant Dis. 16, 326-330.
    CrossRef
  3. Daher, RK, Stewart, G, Boissinot, M, and Bergeron, MG (2016). Recombinase polymerase amplification for diagnostic applications. Clin Chem. 62, 947-958.
    Pubmed CrossRef
  4. Jeong, JJ, Ju, HJ, and Noh, JJ (2014). A review of detection of methods for the plant viruses. Res Plant Dis. 20, 173-181.
    CrossRef
  5. Ji, Z, Zhao, X, Duan, H, Hu, T, Wang, S, Wang, Y, and Cao, K (2013). Multiplex RT-PCR detection and distribution of four apple viruses in China. Acta Virol. 57, 435-441.
    Pubmed CrossRef
  6. Lee, SH, Kwon, YS, Shin, HM, Nam, SY, Hong, EY, Kim, BK, Kim, DE, Cha, BJ, and Cha, JS (2017). Survey on virus infection for commercial nursery trees of major apple cultivars in Korea. Res Plant Dis. 23, 355-362.
  7. Londoño, M, Harmon, CL, and Polston, JE (2016). Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics. Virol J. 13, 48.
    Pubmed KoreaMed CrossRef
  8. Lu, Y, Yao, B, Wang, G, and Hong, N (2018). The detection of ACLSV and ASPV in pear plants by RT-LAMP assays. J Virol Methods. 252, 80-85.
    CrossRef
  9. Mekuria, TA, Zhang, S, and Eastwell, KC (2014). Rapid and sensitive detection of little cherry virus 2 using isothermal reverse transcription-recombinase polymerase amplification. J Virol Methods. 205, 24-30.
    Pubmed CrossRef
  10. Piepenburg, O, Williams, CH, Stemple, DL, and Armes, NA (2006). DNA detection using recombinase proteins. PLoS Biol. 4, e204.
    CrossRef
  11. Silva, G, Bömer, M, Nkere, C, Kumar, PL, and Seal, SE (2015). Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification. J Virol Methods. 222, 138-144.
    Pubmed CrossRef
  12. Winkowska, L, Grimová, L, and Rysanek, P (2016). Quantitative detection of four fruit viruses in apple trees throughout the year. Phytopathol Mediterr. 55, 207-224.
  13. Yao, B, Wang, G, Ma, X, Liu, W, Tang, H, Zhu, H, and Hong, N (2014). Simultaneous detection and differentiation of three viruses in pear plants by a multiplex RT-PCR. J Virol Methods. 196, 113-119.
    CrossRef
  14. Zhang, SL, Ravelonandro, M, Russell, P, McOwen, N, Briard, P, Bohannon, S, and Vrient, A (2014). Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP (R) using reverse transcription-recombinase polymerase amplification. J Virol Methods. 207, 114-120.
    Pubmed CrossRef
  15. Zhao, L, Feng, CH, Li, BQ, Hao, XA, Liu, H, Wu, YF, and Wang, QC (2014). Rapid detection of apple stem grooving virus by reverse transcription loop-mediated isothermal amplification. J Plant Pathol. 96, 407-409.
    CrossRef