search for




 

A Duplex PCR Assay for Rapid Detection of Phytophthora nicotianae and Thielaviopsis basicola
Plant Pathol. J. 2019;35:172-177
Published online April 1, 2019
© 2019 The Korean Society of Plant Pathology.

Na Liu1, Shijun Jiang2, Songli Feng1, Wenyan Shang1, Guozhen Xing1, Rui Qiu3, Chengjun Li3, Shujun Li3,*, and Wenming Zheng1,*

1College of Life Sciences, Henan Agricultural University, Zhengzhou 450002, China, 2College of Plant Protection, Henan Agricultural University, Zhengzhou 450002, China, 3Key Laboratory for green preservation & control of tobacco diseases and pests in Huanghuai Area, Tobacco Research Institute of Henan Academy of Agricultural Science, Xuchang 461000, China
Correspondence to: *W. Zheng, Phone) +86-371-63555963, FAX) +86-371-63555790
E-mail) wmzheng@henau.edu.cn
S. Li, Phone) +86-374-4511016, FAX) +86-374-4519229
E-mail) 13603749396@126.com
Received September 4, 2018; Revised December 11, 2018; Accepted December 28, 2018.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

A duplex PCR method was developed for simultaneous detection and identification of tobacco root rot pathogens Phytophthora nicotianae and Thielaviopsis basicola. The specific primers for P. nicotianae were developed based on its internal transcribed spacer (ITS) regions of ribosomal gene, ras gene and hgd gene, while the specific primers for T. basicola were designed based on its ITS regions and β-tubulin gene. The specificity of the primers was determined using isolates of P. nicotianae, T. basicola and control samples. The results showed that the target pathogens could be detected from diseased tobacco plants by a combination of the specific primers. The sensitivity limitation was 100 fg/μl of pure genomic DNA of the pathogens. This new assay can be applied to screen out target pathogens rapidly and reliably in one PCR and will be an important tool for the identification and precise early prediction of these two destructive diseases of tobacco.

Keywords : duplex PCR, molecular detection, Phytophthora nicotianae, Thielaviopsis basicola, tobacco
Supplementary Information
Acknowledgements

This work was supported by the Science and Technology Project of Henan Tobacco Company, China (Project No. 201741000027063) and the Self-innovation Project of Henan Academy of Agricultural Science, China (Project No. 2017ZC21). We are grateful to Professor Trevor C. Charles at the University of Waterloo Canada for reading through and editing our manuscript before submission to The Plant Pathology Journal.

Figures
Fig. 1. Duplex PCR results for Phytophthora nicotianae and Thielaviopsis basicola. (A, B) Duplex PCR for primer combination TBITS1419-F/TBITS1419-R of T. basicola with YYI-F/YYI-R and YYH-F/YYH-R of P. nicotianae. 1: DNA mixture of T. basicola and P. nicotianae; 2: DNA mixture of P. nicotianae and T. basicola; 3: DNA of T. basicola; 4: DNA of P. nicotianae; M: DM2000 DNA Marker; CK: control (distilled water). (C, D) Duplex PCR for primer TBβ1419-F/TBβ1419-R of T. basicola combined with YYI-F/YYI-R and YYH-F/YYH-R of P. nicotianae. 1: DNA mixture of T. basicola and P. nicotianae; 2: DNA mixture of P. nicotianae and T. basicola; 3: DNA of P. nicotianae; 4: DNA of T. basicola; M: DM2000 DNA Marker; CK: control (distilled water).
Tables

Primers for the detection of Phytophthora nicotianae and Thielaviopsis basicola

SpeciesGene namePrimer namePrimer sequence
Phytophthora nicotianaerDNA-ITSYYI-FTCATTACCACACCTAAAAAACT
YYI-RACTTTCGTCCCCACAGTATATT
RasYYRAS1414-F2CTCCAGATTGTACGTCTTTCA
YYRAS1414-R2AATATCACTCAGCTCTTTTCC
HgdYYH-FTTCCATTATTTCATCGTGGAAAAAT
YYH-RGCAAAATACTTTGGGAATGGGA
Thielaviopsis basicolarDNA-ITSTBITS1419-FGTGTTGGAGGACCCGCGTTTAG
TBITS1419-RAGTTGAGGGTTTTTCGGCATGTT
β-tubulinTBβ1419-FCATCTGGTCCTCAACCTCCTTCAT
TBβ1419-RCACACATTGCTAACCCGTCTCTTT
References
  1. Almario J, Kyselková M, Kopecký J, Ságová-Marečková M, Muller D, Grundmann GL, and Moënne-Loccoz Y. 2013. Assessment of the relationship between geologic origin of soil, rhizobacterial community composition and soil receptivity to tobacco black root rot in Savoie region (France). Plant Soil 371: 397-408.
    CrossRef
  2. Anderson TR, and Welacky TW. 1988. Populations of Thielaviopsis basicola in burley tobacco field soils and the relationship between soil inoculum concentration and severity of disease on tobacco and soybean seedlings. Can J Plant Pathol 10: 246-251.
    CrossRef
  3. Bian CH, Ding YQ, Zhao SM, Li SJ, and Kang YB. 2017. Molecular identification and pathogenicity analysis of Thielaviopsis basicola in Henan Province. Tobacco Sci Technol 50: 8-14. (in Chinese)
  4. Blair JE, Coffey MD, Park SY, Geiser DM, and Kang S. 2008. A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet Biol 45: 266-277.
    Pubmed CrossRef
  5. Chen RT, Zhu XC, Wang ZJ, Guo ZY, Dong HS, Wang LZ, Liu YR, and Shi JK. 1997. A report of investigating and studying tobacco infectious diseases of 16 ma in tobacco producing provinces (regions) in China. Chin Tob Sci 18: 1-7. (in Chinese)
  6. Cheng Y, Wang W, Yao J, Huang L, Voegele RT, Wang X, and Kang Z. 2016. Two distinct Ras genes from Puccinia striiformis exhibit differential roles in rust pathogenicity and cell death. Environ Microbiol 18: 3910-3922.
    Pubmed CrossRef
  7. Cullen DW, Lees AK, Toth IK, and Duncan JM. 2001. Conventional PCR and real-time quantitative PCR detection of Helminthosporium solani in soil and on potato tubers. Eur J Plant Pathol 107: 387-398.
    CrossRef
  8. Dodd SL, Hill RA, and Stewart A. 2004. A duplex-PCR bioassay to detect a Trichoderma virens biocontrol isolate in non-sterile soil. Soil Biol Biochem 36: 1955-1965.
    CrossRef
  9. Geldenhuis MM, Roux J, Wingfield MJ, and Wingfield BD. 2004. Development of polymorphic markers for the root pathogen Thielaviopsis basicola using ISSR-PCR. Mol Ecol Notes 4: 547-550.
    CrossRef
  10. Grasko JM, Hooper AJ, Brown JW, Mcknight CJ, and Burnett JR. 2009. A novel missense HGD gene mutation, K57N, in a patient with alkaptonuria. Clin Chim Acta 403: 254-256. (in Chinese)
    Pubmed CrossRef
  11. Grote D, Olmos A, Kofoet A, Tuset JJ, Bertolini E, and Cambra M. 2002. Specific and sensitive detection of Phytophthora nicotianae by simple and nested-PCR. Eur J Plant Pathol 108: 197-207.
    CrossRef
  12. Guiltinan MJ, Velten J, Bustos MM, Cyr RJ, Schell J, and Fosket DE. 1987. The expression of a chimeric soybean beta-tubulin gene in tobacco. Mol Genet Genomics 207: 328-334.
    CrossRef
  13. Haudenshield JS, Song JY, and Hartman GL. 2017. A novel, multiplexed, probe-based quantitative PCR assay for the soybean root- and stem-rot pathogen, Phytophthora sojae, utilizes its transposable element. PloS One 12: e0176567.
    Pubmed KoreaMed CrossRef
  14. Huang JL, Wu JZ, Li CJ, Xiao CG, and Wang GX. 2010. Detection of Phytophthora nicotianae in soil with realtime quantitative PCR. J Phytopathol 158: 15-21.
    CrossRef
  15. Ippolito A, Schena L, and Nigro F. 2002. Detection of Phytophthora nicotianae and P. citrophthora in citrus roots and soils by nested PCR. Eur J Plant Pathol 108: 855-868.
    CrossRef
  16. Kong P, Hong C, Jeffers SN, and Richardson PA. 2003. A Species-specific polymerase chain reaction assay for rapid detection of Phytophthora nicotianae in irrigation water. Phytopathology 93: 822-831.
    Pubmed CrossRef
  17. Lacourt I, and Duncan JM. 1997. Specific detection of Phytophthora nicotianae using the polymerase chain reaction and primers based on the DNA sequence of its elictin gene ParA1. Eur J Plant Pathol 103: 73-83.
    CrossRef
  18. Leclerc-Potvin C, Balmas V, Charest PM, and Jabaji-Hare S. 1999. Development of reliable molecular markers to detect non-pathogenic binucleate Rhizoctonia isolates (AG-G) using PCR. Mycol Res 103: 1165-1172.
    CrossRef
  19. Lévesque CA, Harlton CE, and de Cock AW. 1998. Identification of some oomycetes by reverse dot blot hybridization. Phytopathology 88: 213-222.
    Pubmed CrossRef
  20. Li B, Liu P, Xie S, Yin R, Weng Q, and Chen Q. 2015. Specific and sensitive detection of Phytophthora nicotianae by nested PCR and loop-mediated isothermal amplification assays. J Phytopathol 163: 185-193.
    CrossRef
  21. Li MZ, Asano T, Suga H, and Kageyama K. 2011. A multiplex PCR for the detection of Phytophthora nicotianae and P. cactorum, and a survey of their occurrence in strawberry production areas of Japan. Plant Dis 95: 1270-1278.
    Pubmed CrossRef
  22. Markoulatos P, Siafakas N, and Moncany M. 2002. Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal 16: 47-51.
    Pubmed CrossRef
  23. Meng J, and Wang Y. 2010. Rapid Detection of Phytophthora nicotianae in infected tobacco tissues and soil samples based on its Ypt 1 gene. J Phytopathol 158: 1-7.
    CrossRef
  24. Raeder U, and Broda P. 1985. Rapid preparation of DNA from filamentous fungi. Lett Appl Microbiol 1: 17-20.
    CrossRef
  25. Shew HD. 1985. Response of Phytophthora parasitica var. nicotianae to metalaxyl exposure. Plant Dis 69: 559-562.
    CrossRef
  26. Shew HD. 1987. Effect of host resistance on spread of Phytophthora parasitica var. nicotianae and subsequent development of tobacco black shank under field conditions. Phytopathology 77: 1090-1093.
    CrossRef
  27. Sudan V, Jaiswal AK, Parashar R, and Shanker D. 2015. A duplex PCR based assay for simultaneous detection of Trypanosoma evansi and Theileria annulata infections in water buffaloes. Trop Anim Health Prod 47: 915-919.
    Pubmed CrossRef
  28. Tooley PW, Bunyard BA, Carras MM, and Hatziloukas E. 1997. Development of PCR primers from internal transcribed spacer region 2 for detection of Phytophthora species infecting potatoes. Appl Environ Microbiol 63: 1467-1475.
    Pubmed KoreaMed
  29. Xie YH, Zhang YG, Zhu LQ, You DG, and Lu Y. Array. Research advances in integrated management of tobacco black shank. Curr Biotechnol: 41-46. (in Chinese)
  30. Zhang XG, Zheng GS, Han HY, Han W, Shi CK, and Chang CJ. 2008. RAPD PCR for diagnosis of Phytophthora parasitica var. nicotianae isolates which cause black shank on tobacco. J Phytopathol 149: 569-574.
    CrossRef
  31. Zhu CX, Wang YT, and Wang ZF. 2002. Tobacco diseases of China . China Agriculture Press, Beijing, China. 350 pp (in Chinese).