Plant Pathol J > Volume 32(5); 2016 > Article
Cho, Igori, Lim, Choi, Hammond, Lim, and Moon: Deep Sequencing Analysis of Apple Infecting Viruses in Korea

Abstract

Deep sequencing has generated 52 contigs derived from five viruses; Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV), Apple green crinkle associated virus (AGCaV), and Apricot latent virus (ApLV) were identified from eight apple samples showing small leaves and/or growth retardation. Nucleotide (nt) sequence identity of the assembled contigs was from 68% to 99% compared to the reference sequences of the five respective viral genomes. Sequences of ASPV and ASGV were the most abundantly represented by the 52 contigs assembled. The presence of the five viruses in the samples was confirmed by RT-PCR using specific primers based on the sequences of each assembled contig. All five viruses were detected in three of the samples, whereas all samples had mixed infections with at least two viruses. The most frequently detected virus was ASPV, followed by ASGV, ApLV, ACLSV, and AGCaV which were withal found in mixed infections in the tested samples. AGCaV was identified in assembled contigs ID 1012480 and 93549, which showed 82% and 78% nt sequence identity with ORF1 of AGCaV isolate Aurora-1. ApLV was identified in three assembled contigs, ID 65587, 1802365, and 116777, which showed 77%, 78%, and 76% nt sequence identity respectively with ORF1 of ApLV isolate LA2. Deep sequencing assay was shown to be a valuable and powerful tool for detection and identification of known and unknown virome in infected apple trees, here identifying ApLV and AGCaV in commercial orchards in Korea for the first time.

Introduction

Apple is an economically important fruit crop, covering an area of 19,313 ha with an annual production of about 583,000 tonnes in Korea (http://kostat.go.kr, 2015). Apple trees are affected by at least 12 viruses and virus like diseases, which cause significant economic losses (Németh, 1986; Nisar, 2013; Saade et al., 2000). Among these viruses, Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV), and Apple mosaic virus (ApMV) commonly occur in commercial apple orchards around the world. Previous surveys indicated that 47.6% of apple trees in Korea are infected by ACLSV, ASGV, and ASPV (Cho, 2015), but ApMV has not been detected in recent years in Korea. For the certification of apple plant material, rootstocks and cultivars have been tested along with other pathogens including four viruses, ACLSV, ASGV, ASPV, and ApMV; the use of certified healthy plant materials can prevent virus spread in commercial apple orchards.
Virus control is based mainly on prevention such as planting healthy propagation materials and the eradication of infected plants (Mathews, 2010; Rowhani et al., 1995). Therefore, reliable and sensitive virus detection methods are critical in successful screening for healthy plant materials (Sastry, 2013). Traditional virus detection assays such as woody indicators, ELISA, molecular hybridization, and RT-PCR are optimized for the detection of known viruses. However, novel and highly divergent viruses are not easily detected by the assays that depend on prior availability of specific antibodies or knowledge of sequences (Yozwiak et al., 2012). More recently, deep sequencing (or next generation sequencing) assay has provided a powerful alternative for the detection and identification of the total pathogen load in infected plants (the virome being the the totality of viral pathogens in an infected plant) without a priori knowledge (Li et al., 2012). Deep sequencing assay has been applied for virome diagnostics in fruit crops (Barba et al., 2014; Coetzee et al., 2010). In apples, Yoshikawa et al. (2012) identified ASGV, ASPV, ACLSV, Apricot latent virus (ApLV), Apricot pseudo-chlorotic leaf spot virus (ApPCLSV), and Peach chlorotic mottle virus (PCMV) from green crinkle disease of apple trees. In grapevines, Al Rwahnih et al. (2009, 2012) identified a novel Marafivirus, Grapevine Syrah virus-1 (GSyV-1) associated with grapevine syrah decline (2009), a novel circular DNA virus, Grapevine red blotch-associated virus (GRBaV) associated with grapevine red blotch disease and a novel Vitivirus, Grapevine virus F (GVF) from infected grapevine (2012). Giampetruzzi et al. (2012) discovered a novel RNA virus, Grapevine Pinot gris virus (GPGV) from infected grapevine. In Prunus spp., Candresse et al. (2013) identified Plum pox virus, Prunus necrotic ringspot virus and novel viral agents from prunus materials and a Little cherry virus 1 (LChV1) isolate associated with Shirofugen stunt disease syndrome of cherry plants. These previous studies indicate the usefulness of deep sequencing assay approach to identify both known viruses and new viruses from infected fruit crops. Thus, deep sequencing assay can be used effectively as a first step to control virus diseases in certification programs aimed at elimination of both known and unknown pathogens from plant materials.
Virus-like symptoms of small leaves and/or growth retardation were observed in domestic commercial apple orchards but the disease etiology was unknown. The aim of this study was to apply deep sequencing assays to discover any novel viral genomes and to evaluate the viruses present in apple samples collected in Korea.

Materials and Methods

Plant material and cDNA library construction

Eight samples were sourced from apple trees showing small leaves and/or growth retardation in commercial orchards of Muju, Bonghwa, Boeun, and Yesan provinces during 2011 (Fig. 1). Leaves were collected from symptomatic trees and subjected to laboratory analysis to define the etiology. Total RNA was extracted using the Tri Reagent (Molecular Research Center, Cincinnati, OH, USA) following manufacturer’s instructions. Equal amounts of total RNA from each sample were pooled. Ribo-Zero Magnetic Kit (Epicentre, Madison, WI, USA) was used to remove ribosomal RNA (rRNA) from the total RNA for cDNA library construction and sequencing. A random-primed cDNA library was constructed using a TrueqRNA sample prep Kit (Illumina, San Diego, CA, USA) and BluePippin 2% Agarose Gel Cassettes (Sage Science, Beverly, MA, USA), targeting fragments ranging between 300 bp and 400 bp.

Sequencing and sequence analysis

The library was sequenced on an Illumina HiSeq 2500 to generate 101 nucleotide (nt) paired-end reads. The paired-end sequence reads were filtered by the NGS QC Toolkit v2.3.3 (Patel and Jain, 2012) to eliminate low quality sequences (phred score ≤ 25) and short reads (length ≤ 20). In addition, the filtered raw sequence reads mapped to the known plant mRNA and the other RNA collections derived from PlantGDB were discarded. De novo assemblies were performed with Velvet version 1.2.09 (Zerbino and Birney, 2008) and the assembled contigs were subjected to search for viral genome sequences using BLAST version 2.2.26. A comparative taxonomic analysis of the BLAST results was performed with MEGA version 5 (Tamura, et al., 2011).

RT-PCR and phylogenetic analysis

Partial genomes of five viruses were retrieved from the BLAST results of assembled contigs as follows: ACLSV, ASGV, ASPV, Apple green crinkle associated virus (AGCaV), and ApLV. RT-PCR was used to confirm the presence of five viruses in the eight symptomatic apple samples. Primers were designed according to the sequences of each assembled contig related to the five viral genomes identified (Table 1). For phylogenetic analysis, nucleic acid sequences were aligned using Clustal W and trees were generated with MEGA v5.05 program (Tamura et al., 2011) using neighbor-joining method.

Results

Deep sequencing analysis

The deep sequencing of eight apple samples produced paired-end sequence data of 486,469,736 reads. After plant sequence filtering for non-viral RNAs, 319,249,571 raw reads were obtained and subjected to de novo assembly, generating a total of 1,288,953 contigs. BLAST search of the assembled contigs identified fifty two contigs ranging from 500 to 3,300 nt in size with an average of 900 nt in the reference sequences of National Center for Biotechnology Information virus database, which suggested significant similarity with five viruses: ACLSV, AGCaV, ASGV, ASPV, and ApLV (Table 2). These viruses all belong to the familyBetaflexiviridae, i.e., genus Trichovirus (ACLSV), Foveavirus (AGCaV, ASPV, and ApLV), and Capillovirus (ASGV). The nt sequence comparison of the assembled contigs showed from 68% to 99% identity compared to the reference sequences of the five known viral genomes. ASPV and ASGV were the most abundant virus species in this census. ASPV constituted 51.9%, ASGV 34.6%, ApLV 5.8%, ACLSV 3.9%, and AGCaV 3.9% of the fifty two contigs (Fig. 2). ApLV and AGCaV were not previously reported in domestic apple commercial orchards, and were thus identified here for the first time in Korea.
Some of the ASGV contigs were initially identified by BLAST search as most closely related to database sequences labeled as ‘Citrus tatter leaf virus’ (CTLV), which was initially described as a separate species affecting distinct hosts. However, ‘CTLV’ has been recognized by the International Committee on Taxonomy of Viruses (ICTV) since the seventh report (Martelli et al., 2000) as a strain of ASGV. We therefore refer here only to ASGV, although overlapping contigs with distinct sequences were identified for several regions of the ASGV genome (Fig. 3C).

Detection of the five viruses in the samples

The presence of five viruses was confirmed by RT-PCR from the eight apple tree samples. All contig sequences derived from deep sequencing were represented on the viral genomes of ACLSV, ASGV, ASPV, AGCaV, and ApLV, respectively (Fig. 3) and primers were designed based on the sequences of each assembled contig (Table 1).
In RT-PCR using the designed primers, the five viruses were successfully detected in the samples as shown in Table 3. All five viruses were detected in one sample from Bonghwa and two from Yesan, all showing small leaves and/or growth retardation; however, only ASGV and ASPV were detected in a sample from Muju with the same growth retardation symptoms as observed in Yesan. These results suggested that the relationship of these viruses to symptom expression in apple trees was not clear. Two or three viruses were detected in each of the other samples. The most frequently detected virus was ASPV, followed by ASGV, ApLV, ACLSV, and AGCaV, which were each detected in multiple infections in the samples tested; none of the samples were infected by less than two viruses (Table 3). Although AGCaV and ApLV were identified here for the first time in Korea, each was present in five to six samples from Bonghwa, Yesan, and Boeun, which indicated that these viruses may occur at significant frequency in domestic commercial apple orchards.

Sequence analysis of newly identified viruses

AGCaV was identified in two contigs, ID 1012480 and 93549. These two contigs were respectively 736 and 2,746 nt in length, showing 82% and 78% nt sequence identity with ORF1 of the AGCaV genome retrieved from GenBank (accession No. HE963831). The phylogenetic relationship between the AGCaV isolate identified from these two contigs and viruses in the genus Foveavirus such as ASPV, ApLV, PCMV, Asian prunus virus (APV), and Grapevine rupestris stem pitting virus (GRSPV) was investigated because it is known that members of the genus Foveavirus display high levels of genetic diversity (James et al., 2013; Komorowska et al., 2011; Youssef et al., 2011). In phylogenetic analysis, the contigs ID 93549 and 1012480 were most closely related to AGCaV than to ASPV and ApLV, respectively, but had a more distant relationship to APV and GRSPV (Fig. 4). The results suggested that the contig ID 93549 and 1012480 might represent new isolates of AGCaV. The contig ID 1012480 of AGCaV isolate was detected in samples B-F and H of Fig. 1 (Fig. 5). The contig ID 93549 of AGCaV isolate was detected only in samples D and H of Fig. 1 (Fig. 5).
ApLV was identified in three contigs, ID 65587, 1802365, and 116777. These three contigs of 1,551, 959, and 1,027 nt in length showed 77%, 78%, and 76% nt sequence identity respectively with ORF1 of ApLV genome retrieved from GenBank (accession No. HQ339958). In phylogenetic analysis of viruses in the genus Foveavirus, the contig ID 116777 was most closely related to ApLV but only distantly to the type isolates of APV and GRSPV (Fig. 6). The contigs ID 65587 and 1802365 had similar relationships (data not shown). The results suggested that the three contigs might represent new isolates of ApLV. The contig ID 116777 of ApLV isolate was detected in samples D-F and H of Fig. 1 (Fig. 7).
ASPV was identified in twenty-seven contigs, ranging from 508 to 3,325 nt in size. These contigs had DNA sequences with from 68% to 94% identities to known ASPV isolates. Especially, contig ID 86056 of 1,048 nt in length showed only 68% nt sequence identity with ORF1 of ASPV genome retrieved from GenBank (accession No. KF915809). In phylogenetic analysis, this contig was related to ASPV, but appeared to be a distinct virus species of the genus Foveavirus (Fig. 8). The results suggested that the contig ID 86056 is derived from a new Foveavirus most closely related to ASPV. Presence of the sequence represented by contig ID 86056 was confirmed in samples D and H of Fig. 1 by RT-PCR with specific primers (Fig. 9).

Discussion

There are over 25 diseases of unknown etiology that affect apple trees (Howell et al., 2011). Recently, deep sequencing assay has revealed sequences associated with some diseases of unknown etiology (Barba et al., 2014). In this study, the deep sequencing has generated fifty two contigs related to five viruses, ACLSV, ASGV, ASPV, AGCaV, and ApLV from eight apple samples showing small leaves and/or growth retardation. The presence of five viruses was confirmed in the samples by RT-PCR using specific primers based on the sequences of each of the selected contigs for each virus.
The ASPV isolates were the most abundant virus species in the assembled fifty two contigs, having sequence variants with from 68% to 94% identities with previously reported ASPV isolates. In previous studies, the variable regions of ASPV genome are located between the MET and P-Pro domains, and located in the putative movement protein overlapping the N-terminal coat protein (CP) coding region in pome fruit trees (Gadiou et al., 2010; Magome et al., 1999; Yoshikawa and Takahashi, 1988). Especially, the contig ID 86056 detected in only two samples had a nt sequence that was 68% identical when compared to the corresponding sequence of the definitive ASPV isolate YT. Based on the ICTV criteria for species demarcation in the genus Foveavirus, distinct species have less than ca. 72% identical nt or 80% identical aa between their entire CP or replication protein genes (Adams et al., 2004). The contig ID 86056 might represent a new Foveavirus species. Although the result of the genetic diversity of ASPV isolates in this work is very similar with previous reports, the ASPV complete genomes of the assemble contigs need further study to improve understanding of the extent of genetic diversity.
The detection of ‘ASGV-like’ and ‘CTLV-like’ sequences among the ASGV contigs is similar to the report of Yoshikawa et al. (1996), in which a typical ASGV isolate and a CTLV-like isolate were detected in a mixed infection in Japanese pear. In this study both typical ASGV and a ‘CTLV-like’ isolate were detected in a sample from Yesan, suggesting that mixed infection of a single tree by two distinct isolates is probably a commonplace occurrence for ASGV, as has been shown for several other viruses including the potexviruses Pepino mosaic virus (PepMV; Maroon-Lango et al., 2005), Alternanthera mosaic virus (AltMV; Lim et al., 2010), and Plantago asiatica mosaic virus (PlAMV; Komatsu et al., 2008).
AGCaV and ApLV identified from the assembled contigs were not previously known or studied in Korea. AGCaV was identified in two contigs assembled of contig ID 1012480 and 93549, which showed 82% and 78% nt sequence identities with ORF1 of AGCaV isolate Aurora-1. AGCaV was identified from Aurora Golden Gala apple showing severe symptoms of green crinkle disease (James et al., 2013). Although AGCaV amplicons derived from contig ID 101240 were detected in six of the samples (B-F and H), the green crinkle symptom of apples could not be observed during the survey. Sequences related to AGCaV contig ID 93549 were detected in only two samples (D and H), suggesting that at least two AGCaV variants are present among the trees sampled; this indicates either the probability of multiple introductions into Korea, or of the presence and divergence of AGCaV over a long period. ApLV was identified in three contigs assembled of contig ID 65587, 1802365, and 116777, which showed 77%, 78%, and 76% nt sequence identities with ORF1 of ApLV isolate LA2. Although ApLV might not have been considered fully distinct at the time of the report of Nemchinov et al. (2000), it has been recognized as a species separate from ASPV by the ICTV since 2004. ApLV is mostly latent in the natural host such as peach and cherry, but not in apple plants (Németh, 1986). Although ApLV isolates were detected in five samples by RT-PCR, the analysis of complete genome is needed for the accurate identification of virus species in the genus Foveavirus.
Failure to detect ApMV is consistent with absence of detection of ApMV in other surveys of fruit tree viruses in Korea (Cho, 2015). Although all of the other viruses detected are flexuous viruses with poly-adenylated genomes, the cDNA libraries used for deep sequencing were prepared using random primers, which should have resulted in detection of ApMV if it had been present in any of the samples tested.
These results show that the deep sequencing assay was a significant and powerful tool for detection and identification of known and unknown viruses in the virome of infected apple trees. Accordingly, the assay can be applied to the other fruit crops such as pear, grapevine, peach, and persimmon for virome discovery, and the identification of viruses associated with diseases of unknown etiology in Korea. Furthermore, the assay will be available for the monitoring of viruses for quarantine and routine diagnosis in certification programs by providing fast and accurate virome information in the near future.

Acknowledgments

This research was carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ01007702)” Rural Development Administration, Republic of Korea.

Notes

Articles can be freely viewed online at www.ppjonline.org.

Fig. 1
Characteristic symptoms in apple trees show growth retardation from Muju (A), small leaves and leaf curling from Bonghwa (B), small leaves from Bonghwa (C), growth retardation and leaf chlorosis from Bonghwa (D), growth retardation from Yesan (E), small leaves and growth retardation from Yesan (F), small leaves and shortened internodes from Bonghwa (G), and small leaves and leaf curling from Boeun (H).
ppj-32-441f1.gif
Fig. 2
Comparative percentages of five viral genomes among fifty two contigs according to alignment with BLAST searches. ASPV, Apple stem pitting virus; ASGV, Apple stem grooving virus; ApLV, Apricot latent virus; ACLSV, Apple chlorotic leaf spot virus; AGCaV, Apple green crinkle associated virus.
ppj-32-441f2.gif
Fig. 3
Position and distribution of the assembled contigs in five viral genomes: (A) ACLSV, (B) AGCaV, (C) ASGV, (D) ASPV, and (E) ApLV. MET, methyltransferase; P, papain-like protease; HEL, nucleotide triphosphate-binding helicase; POL, RNA-dependent RNA polymerase; MP, movement protein; CP, coat protein; C, cysteine protease; V, variable region.
ppj-32-441f3.gif
Fig. 4
Phylogenetic analysis of the genome sequence showing the relationship of contig ID 1012480 (A) and 93549 (B) of AGCaV isolates with available sequences in the genus Foveavirus. Viruses include ASPV, ApLV, PCMV, APV, and GRSPV. AGCaV, Apple green crinkle associated virus; ASPV, Apple stem pitting virus; ApLV, Apricot latent virus; APV, Asian prunus virus; PCMV, Peach chlorotic mottle virus; GRSPV, Grapevine rupestris stem pitting virus.
ppj-32-441f4.gif
Fig. 5
Confirmation of the presence of Apple green crinkle associated virus isolates in the infected apple samples by RT-PCR using primers derived from contig ID 93549 (A) and 1012480 (B). Lanes 1 to 8 correspond to samples A to H of Fig. 1. M, 10 kb ladder DNA marker. Arrows indicate the size of the specific PCR products.
ppj-32-441f5.gif
Fig. 6
Phylogenetic analysis of the genome sequence showing the relationship of contig ID 116777 ApLV isolate to available sequences in the genus Foveavirus. ASPV, Apple stem pitting virus; AGCaV, Apple green crinkle associated virus; ApLV, Apricot latent virus; GRSPV, Grapevine rupestris stem pitting virus; PCMV, Peach chlorotic mottle virus; APV, Asian prunus virus.
ppj-32-441f6.gif
Fig. 7
Confirmation of Apricot latent virus infection in the infected apple samples by RT-PCR using primers derived from contig ID 116777. Lanes 1 to 8 correspond to samples A to H of Fig. 1. M, 10 kb ladder DNA marker. Arrows indicate the size of the specific PCR product.
ppj-32-441f7.gif
Fig. 8
Phylogenetic analysis of the genome sequence showing the relationship of Contig ID 86056 to available sequences of viruses in the genus Foveavirus. ApLV, Apricot latent virus; ASPV, Apple stem pitting virus; AGCaV, Apple green crinkle associated virus; APV, Asian prunus virus; PCMV, Peach chlorotic mottle virus; GRSPV, Grapevine rupestris stem pitting virus.
ppj-32-441f8.gif
Fig. 9
Confirmation of the presence of Apple stem pitting virus in infected apple samples by RT-PCR using primers derived from contig ID 86056. Numbers 1 to 8 correspond to samples A to H of Fig. 1. Lane A, contig ID 89192; lane B, contig ID 136415; lane C, contig ID 141873; lane D, contig ID 204809; lane E, contig ID 271566; lane F, contig ID 273023; lane G, contig ID 302849; lane H, contig ID 307196; lane I, contig ID 320605; lane J, contig ID 343250; lane K, contig ID 417032; lane L, contig ID 86056. M, 10 kb ladder DNA marker. Arrows indicate the size of the specific PCR product of contig ID 86056.
ppj-32-441f9.gif
Table 1
List of the primers used to detect assembled sequences of five viral genomes
Contig ID Annotation (BLASTn) Primer Sequence (5′-3′) Expected size (bp)
726702 ACLSV 726702_For GTCTCTTACCCAACTTTTGA 410
726702_Rev ATGCTGACGAACAAGCAGTC
1012480 AGCaV 1012480_For GAAGTTCAGCCCGATTGT 510
1012480_Rev GGTGGAAATAGCTGAATCTC
93549 AGCaV 93549_For AAGTGTTAAGTCAACTGCAG 720
93549_Rev CTGTATGAGACATTGATTGT
281674 ASGV 281674_For AGACTTGGGTCATTGGCAATAAT 630
281674_Rev TGGCGTCCTTGTAAAGCTCCGAT
540265 ASGV 540265_For TCTTGACATGGAAAAGAATG 430
540265_Rev ACATGCTAGAGTTTGGCCAG
846750 ASGV 846750_For AATCTCTGGG CATGTACAAT 760
846750_Rev GACACGTCAA AGTCGTCCCT
34776 ASGV 34776_For CACCATCAAGCTTCAGATGACGT 403
34776_Rev TCAACATGGGACCAAATCTGAAC
121616 ASPV 121616_For GGAATCAGATTATGAGGCAT 680
121616_Rev CACATATCTGAAATTGAGAT
271566 ASPV 271566_For TCACTCAACTGGAAGGATGACTT 840
271566_Rev GTCAAGGAAGACTAGGTTACCATGA
273023 ASPV 273023_For GTATTGGCTCCACTTCGGCTCTT 490
273023_Rev TCATGTCCAGGCACACTTTCAAC
307196 ASPV 307196_For AGTACACCCTTTGGGACAGCATAC 644
307196_Rev ACTGCTCTGTGGTGATATCACCA
320605 ASPV 320605_For GAATGTGAATTGTCAGATTTGAC 420
320605_Rev TATTACACATCCATTCACGG GC
343250 ASPV 343250_For GAGTCTGATTATGAGGCTTTTGAT 456
343250_Rev CCAGATTCCTAGTCTCTCTGGC
417032 ASPV 417032_For CAATCCGTGGTGCTATACCTTC 493
417032_Rev GTCTGGCAACATATTTGTGTTCA
188422 ASPV 188422_For GATGATCACAGCAAGAATAG 710
188422_Rev TTGATGAAAGTGTAATCGGC
89192 ASPV 89192_For GGTTCTTCTTTCATGATGAG 700
89192_Rev ACCACTTTAAAGTTTCTAGA
136415 ASPV 136415_For TATAGCCTTCCCAGGGGATT 530
136415_Rev CAGTTCTAGGTAAACCAGCC
141873 ASPV 141873_For TATTATGGGCTTGAGGCTGTGCG 580
141873_Rev ATACCTCATGTATGGAGCAAATC
204809 ASPV 204809_For TGGATGTGTGATAAGAGCAATCGC 530
204809_Rev CGAATGTACCCAGAATCATTATCA
302849 ASPV 302849_For GAAGTCCTAAAGGCTGCAACATTG 634
302849_Rev CCGGGAGATTTTTCGATGAA
305081 ASPV 305081_For GAA GCTGTGAGAG CTCAATGGGT 353
305081_Rev GCATGCACTGCATCACTCATCA
86056 ASPV 86056_For TGGGATCGTCTCAAGATCTATC 580
86056_Rev ATGATCAGGGTCATAAATATCCT
281854 ASPV 281854_For ACTTGGTCGTCG CGAAGTTGAC 372
281854_Rev TGGAAGCTCGATCAATTGATGGT
65587 ApLV 65587_For GGCTGAGAGGTATGAGTCCA 650
65587_For CGATCAAGTCTGGAGGGAGC
116777 ApLV 116777_For AGATCATCCTTCCAGTTGAG 430
116777_Rev TCTTCAATGGATTCGAGGCT

ACLSV, Apple chlorotic leaf spot virus; AGCaV, Apple green crinkle associated virus; ASGV, Apple stem grooving virus; ASPV, Apple stem pitting virus; ApLV, Apricot latent virus.

Table 2
List of fifty two contigs for viral genomes identified according to alignment in the reference sequences of National Center for Biotechnology Information virus database with BLAST searches
No. Contig ID Length (bp) Annotation (BLASTn) Query coverage (%) Identity (%)
1  555989 911      ACLSV 99     89
2  726702 551      ACLSV 96     83
3  1012480 736      AGCaV 99     82
4  93549 2746      AGCaV 99     78
5  107125 550      ASGV 98     94
6  281674 1624      ASGV 99     83
7  322376 1346      ASGV 100     93
8  333749 1140      ASGV 100     96
9  3480 703      ASGV 99     91
10  540265 590      ASGV 100     84
11  734572 739      ASGV 100     92
12  746453 576      ASGV 99     95
13  936228 524      ASGV 100     99
14  276880 717      ASGV 100     91
15  292546 941      ASGV 100     96
16  438226 840      ASGV 99     98
17  624080 554      ASGV 88     99
18  728500 529      ASGV 100     97
19  790540 753      ASGV 100     93
20  846750 1138      ASGV 95     82
21  34776 590      ASGV 91     84
22  360256 723      ASGV 98     79
23  114111 734      ASPV 99     87
24  1204668  830      ASPV 85     90
25  121616 3285      ASPV 99     82
26  271566 3115      ASPV 100     78
27  273023 813      ASPV 99     75
28  274366 561      ASPV 99     87
29  307196 1103      ASPV 98     84
30  320605 515      ASPV 98     84
31  343250 754      ASPV 100     84
32  417032 3325      ASPV 92     83
33  188422 2518      ASPV 99     81
34  450691 877      ASPV 100     88
35  486206 584      ASPV 100     94
36  517940 574      ASPV 99     90
37  680138 635      ASPV 100     88
38  89192 980      ASPV 99     81
39  92742 636      ASPV 98     92
40  935900 917      ASPV 99     79
41  136415 932      ASPV 100     83
42  141873 984      ASPV 99     79
43  204809 819      ASPV 99     83
44  302849 1291      ASPV 99     81
45  355646 714      ASPV 99     87
46  768443 802      ASPV 98     85
47  305081 530      ASPV 99     81
48  86056 1048      ASPV 98     68
49  281854 508      ASPV 99     82
50  65587 1551      ApLV 88     77
51  1802365 959      ApLV 99     78
52  116777 1077      ApLV 100     76

ACLSV, Apple chlorotic leaf spot virus; AGCaV, Apple green crinkle associated virus; ASGV, Apple stem grooving virus; ASPV, Apple stem pitting virus; ApLV, Apricot latent virus.

Table 3
Viruses of eight apple samples detected by RT-PCR
 Sample*  Location  RT-PCR results

 ACLSV   AGCaV   ASGV   ASPV   ApLV 
A  Muju + +
B  Bonghwa + + + + +
C  Bonghwa + +
D  Bonghwa + + +
E  Yesan + + + + +
F  Yesan + + + + +
G  Bonghwa + + +
H  Boeun + + +

ACLSV, Apple chlorotic leaf spot virus; AGCaV, Apple green crinkle associated virus; ASGV, Apple stem grooving virus; ASPV,

Apple stem pitting virus; ApLV, Apricot latent virus.

+, positive; -, negative.

* These designations match the images of symptoms shown in Fig. 1.

References

Adams, MJ, Antoniw, JF, Bar-Joseph, M, Brunt, AA, Candresse, T, Foster, GD, Martelli, GP, Milne, RG, Zavriev, SK and Fauquet, CM 2004. The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Arch Virol. 149:1045-1060.
crossref pmid pdf
Al Rwahnih, M, Daubert, S, Golino, D and Rowhani, A 2009. Deep sequencing analysis of RNAs from a grapevine showing Syrah decline symptoms reveals a multiple virus infection that includes a novel virus. Virology. 387:395-401.
crossref pmid
Al Rwahnih, M, Dave, A, Anderson, M, Uyemoto, JK and Sudarshana, MR 2012. In: Association of a circular DNA virus in grapevines affected by red blotch disease in California, In: Proceedings of the 17th Congress of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine (ICVG); eds. by In : B Ferguson, 104-105. October 7-14, 2012; Foundation Plant Services, University of California, Davis, CA, USA.
Barba, M, Czosnek, H and Hadidi, A 2014. Historical perspective, development and applications of next-generation sequencing in plant virology. Viruses. 6:106-136.
crossref pmid pmc
Candresse, T, Marais, A, Faure, C and Gentit, P 2013. Association of Little cherry virus 1 (LChV1) with the Shirofugen stunt disease and characterization of the genome of a divergent LChV1 isolate. Phytopathology. 103:293-298.
crossref pmid
Cho, IS 2015. New approaches of the molecular assays and the surveys of fruit tree viruses in commercial orchards. PhD thesis. Chungnam National University, Daejeon, Korea.
Coetzee, B, Freeborough, MJ, Maree, HJ, Celton, JM, Rees, DJ and Burger, JT 2010. Deep sequencing analysis of viruses infecting grapevines: virome of a vineyard. Virology. 400:157-163.
crossref pmid
Gadiou, S, Kundu, JK, Paunovic, S, Garcia-Diez, P, Komorowska, B, Gospodaryk, A, Handa, A, Massart, S, Birisik, N, Takur, PD and Polischuk, V 2010. Genetic diversity of Flexiviruses infecting pome fruit trees. J Plant Pathol. 92:685-691.
Giampetruzzi, A, Roumi, V, Roberto, R, Malossini, U, Yoshikawa, N, La Notte, P, Terlizzi, F, Credi, R and Saldarelli, P 2012. A new grapevine virus discovered by deep sequencing of virus- and viroid-derived small RNAs in Cv Pinot gris. Virus Res. 163:262-268.
crossref pmid
Howell, WE, Thompson, D and Scott, S 2011. Virus-like disorders of fruit trees with undetermined etiology. In: Virus and virus-like diseases of pome and stone fruits, eds. by A Hadidi, M Barba, T Candresse and W Jelkmann, 259-265. The American Phytopathological Society Press, St. Paul, MN, USA.
James, D, Varga, A, Jesperson, GD, Navratil, M, Safarova, D, Constable, F, Horner, M, Eastwell, K and Jelkmann, W 2013. Identification and complete genome analysis of a virus variant or putative new foveavirus associated with apple green crinkle disease. Arch Virol. 158:1877-1887.
crossref pmid pdf
Komatsu, K, Yamaji, Y, Ozeki, J, Hashimoto, M, Kagiwada, S, Takahashi, S and Namba, S 2008. Nucleotide sequence analysis of seven Japanese isolates of Plantago asiatica mosaic virus (PlAMV): a unique potexvirus with significantly high genomic and biological variability within the species. Arch Virol. 153:193-198.
crossref pmid pdf
Komorowska, B, Siedlecki, P, Kaczanowski, S, Hasiów-Jaroszewska, B and Malinowski, T 2011. Sequence diversity and potential recombination events in the coat protein gene of Apple stem pitting virus. Virus Res. 158:263-267.
crossref pmid
Li, R, Gao, S, Hernandez, AG, Wechter, WP, Fei, Z and Ling, KS 2012. Deep sequencing of small RNAs in tomato for virus and viroid identification and strain differentiation. PLoS One. 7:e37127
crossref pmid pmc
Lim, HS, Vaira, AM, Reinsel, MD, Bae, H, Bailey, BA, Domier, LL and Hammond, J 2010. Pathogenicity of Alternanthera mosaic virus is affected by determinants in RNA-dependent RNA polymerase and by reduced efficacy of silencing suppression in a movement-competent TGB1. J Gen Virol. 91:277-287.
crossref pmid
Magome, H, Yoshikawa, N and Takahashi, T 1999. Single-strand conformation polymorphism analysis of apple stem grooving capillovirus sequence variants. Phytopathology. 89:136-140.
crossref pmid
Maroon-Lango, CJ, Guaragna, MA, Jordan, RL, Hammond, J, Bandla, M and Marquardt, SK 2005. Two unique US isolates of Pepino mosaic virus from a limited source of pooled tomato tissue are distinct from a third (European-like) US isolate. Arch Virol. 150:1187-1201.
crossref pmid pdf
Martelli, GP, Agranovsky, AA, Bar-Joseph, M, Boscia, D, Candresse, T, Coutts, RHA, Dolja, VV, Duffus, JD, Falk, BW, Gonsalves, D, Jelkmann, W, Karasev, A, Minafra, A, Murant, AF, Namba, S, Niblett, CL, Vetten, HJ and Yoshikawa, N 2000. Genus Capillovirus. In: Virus taxonomy: seventh report of the International Committee on Taxonomy of Viruses, eds. by MHV van Regenmortel, CM Fauquet and DHL Bishop, 952-959. Academic Press, San Diego, CA, USA.
Mathews, DM 2010. Optimizing detection and management of virus diseases of plants and emerging tree diseases in Southern California. In: Proceedings of the Landscape Disease Symposium; pp 10-20. October 14, 2010; Camarillo, CA, USA.
Nemchinov, LG, Shamloul, AM, Zemtchik, EZ, Verderevskaya, TD and Hadidi, A 2000. Apricot latent virus: a new species in the genus Foveavirus. Arch Virol. 145:1801-1813.
crossref pmid pdf
Németh, MV 1986. Virus, mycoplasma, and rickettsia diseases of fruit trees. Kluwer Academic, Hingham, MA, USA.
Nisar, AD 2013. Apple stem grooving virus-a review article. Int J Modern Plant Anim Sci. 1:28-42.
Patel, RK and Jain, M 2012. NGS QC toolkit: a toolkit for quality control of next generation sequencing data. PLoS One. 7:e30619
crossref pmid pmc
Rowhani, A, Maningas, MA, Lile, LS, Daubert, SD and Golino, DA 1995. Development of a detection system for viruses of woody plants based on PCR analysis of immobilized virions. Phytopathology. 85:347-352.
crossref
Saade, M, Aparicio, F, Sánchez-Navarro, JA, Herranz, MC, Myrta, A, Di Terlizzi, B and Pallás, V 2000. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction. Phytopathology. 90:1330-1336.
crossref pmid
Sastry, KS 2013. Plant virus and viroid diseases in the tropics volume-1: introduction of plant viruses and sub-viral agents, classification, assessment of loss, transmission and diagnosis. Springer, New York, NY, USA.
Tamura, K, Peterson, D, Peterson, N, Stecher, G, Nei, M and Kumar, S 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 28:2731-2739.
crossref pmid pmc
Yoshikawa, N, Sasamoto, K, Sakurada, M, Takahashi, T and Yanase, H 1996. Apple stem grooving and citrus tatter leaf capilloviruses obtained from a single shoot of Japanese pear (Pyrus serotina). Jpn J Phytopathol. 62:119-124.
crossref
Yoshikawa, N and Takahashi, T 1988. Properties of RNAs and proteins of Apple stem grooving and Apple chlorotic leafspot viruses. J Gen Virol. 69:241-245.
crossref
Yoshikawa, N, Yamagishi, N, Yaegashi, H and Ito, T 2012. Deep sequence analysis of viral small RNAs from a green crinkle-diseased apple tree. Petria. 22:292-297.
Youssef, F, Marais, A, Faure, C, Barone, M, Gentit, P and Candresse, T 2011. Characterization of Prunus-infecting Apricot latent virus-like Foveaviruses: evolutionary and taxonomic implications. Virus Res. 155:440-445.
crossref pmid
Yozwiak, NL, Skewes-Cox, P, Stenglein, MD, Balmaseda, A, Harris, E and DeRisi, JL 2012. Virus identification in unknown tropical febrile illness cases using deep sequencing. PLoS Negl Trop Dis. 6:e1485
crossref pmid pmc
Zerbino, DR and Birney, E 2008. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 18:821-829.
crossref pmid pmc


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2025 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next