Plant Pathol J > Volume 37(6); 2021 > Article
Lee, Fu, Shin, Song, Jang, and Kim: The Small GTPase CsRAC1 Is Important for Fungal Development and Pepper Anthracnose in Colletotrichum scovillei

Abstract

The pepper anthracnose fungus, Colletotrichum scovillei, causes severe losses of pepper fruit production in the tropical and temperate zones. RAC1 is a highly conserved small GTP-binding protein in the Rho GT-Pase family. This protein has been demonstrated to play a role in fungal development, and pathogenicity in several plant pathogenic fungi. However, the functional roles of RAC1 are not characterized in C. scovillei causing anthracnose on pepper fruits. Here, we generated a deletion mutant (ΔCsrac1) via homologous recombination to investigate the functional roles of CsRAC1. The ΔCsrac1 showed pleiotropic defects in fungal growth and developments, including vegetative growth, conidiogenesis, conidial germination and appressorium formation, compared to wild-type. Although ΔCsrac1 was able to develop appressoria, it failed to differentiate appressorium pegs. However, ΔCsrac1 still caused anthracnose disease with significantly reduced rate on wounded pepper fruits. Further analyses revealed that ΔCsrac1 was defective in tolerance to oxidative stress and suppression of host-defense genes. Taken together, our results suggest that CsRAC1 plays essential roles in fungal development and pathogenicity in C. scovillei-pepper fruit pathosystem.

Chili Peppers (Capsicum annuum L.) is one of the most economically important vegetables around the world (Giacomin et al., 2020; Kim et al., 2014; Oo et al., 2017). According to estimates in 2019, peppers (dry and green) were produced about 42.2 million tons in the world (Food and Agriculture Organization of the United Nations, 2021). Although technologies regarding breeding and cultivation have largely improved, the production of peppers is still hindered by many phytopathogens (Ali et al., 2016). Among those, the anthracnose caused by fungal species from Colletotrichum genus, is well known as one of the most devastating fungal diseases on peppers (Giacomin et al., 2020). In the tropical and temperate zones, Colletotrichum scovillei, belonging to Colletotrichum acutatum species complex, is a dominant pathogen for anthracnose on pepper fruits (Caires et al., 2014; Khalimi et al., 2019; Oo et al., 2017; Toporek and Keinath, 2020). Similar to many other fungal pathogens, C. scovillei reproduces massive numbers of conidia, which serve as the major inoculum (Fu et al., 2021). The anthracnose by C. scovillei starts when conidia attach and adhere on the surface of pepper fruits (Fu et al., 2021). Upon recognition of chemical and physical signals from host, the conidia germinate and differentiate appressoria on the tips of germ tubes (Peres et al., 2005). Different to many appressorium-forming fungi, unmelanized appressoria of C. scovillei can penetrate host cuticle (Fu et al., 2021). At early stage of penetration process, dendroid structure is induced in the cuticle layer of pepper fruits (Fu et al., 2021; Liao et al., 2012). Following successful invasion in host epidermal cells, the fungus develops anthracnose disease with numerous acervuli on the typically sunken necrotic lesions (Oo and Oh, 2016). Although foliar diseases have been broadly studied, the development of fruit anthracnose remains investigated (Fu et al., 2021). Therefore, it is of interest to study the molecular mechanisms involved in C. scovillei-pepper fruit pathosystem.
The Rho (known as Ras homologous) GTPases, belonging to Ras superfamily of small GTPase, are a group of conserved GTP-binding enzymes that hydrolyze guanosine triphosphate (GTP) to guanosine triphosphate (GDP) (Van Aelst and D’Souza-Schorey, 1997). The Rho GTPases are commonly considered as molecular switches, which are turned on when the guanine nucleotide exchange factors accelerate the dissociation of the bound GDP, and turned off when the GTPase activating proteins stimulate the hydrolysis of GTP (Cherfils and Zeghouf, 2013). The Rho GTPases contains two functionally important elements: switch I and switch II, which display conformational changes during transition between GTP-bound (active) and GDP-bound (inactive) states (Fu et al., 2018; Smithers and Overduin, 2016). The inactive state GTPases are structurally disordered, while the active state GTPase are conformationally restrained, and bind their partners to trigger distinct downstream signaling pathways (Barthelmes et al., 2020). In the fungal kingdom, the Rho GTPases were firstly characterized in Saccharomyces cerevisiae, which contains six Rho GTPases (Rho1/RhoA, Rho2, Rho3, Rho4, Rho5 and CDC42) in the genome (Harris, 2011). The Rho GTPases regulate many aspects of cellular events during the growth and developments of S. cerevisiae, including cell polarity, cell wall integrity, exocytosis, polarized secretion, and mating projection (Gong et al., 2013; Robinson et al., 1999; Schmidt et al., 1997; Yoshida et al., 2009).
The plant pathogenic filamentous fungi do not contain the Rho5, but they possess another Rho GTPase Rac1, which is not homologous to yeast Rho5 (Harris, 2011). The existence of Rac1 in the plant pathogenic fungi rather than in yeast may be indicative that Rac1 plays important roles in the growth and development of filamentous fungi. To date, the roles of Rac1 have been functionally characterized in several filamentous fungi (Chen et al., 2008; Harris, 2011; Nesher et al., 2011; Rolke and Tudzynski, 2008; Tian et al., 2015; Virag et al., 2007). For example, deletion of Rac1 orthologs in the corn smut fungus Ustilago maydis and vascular wilt fungus Verticillium dahliae cause severe defects in polarized growth and virulence (Mahlert et al., 2006; Tian et al., 2015). Deletion of MgRac1 in the rice blast fungus Magnaporthe grisea causes a dramatic reduction in conidiation and complete defect in appressorium formation and pathogenicity (Chen et al., 2008). The MgRac1 was found to interact with the PAK kinase (Chm1) and NADPH oxidases (Nox1 and Nox2), which are important for appressorium formation and penetration (Chen et al., 2008; Egan et al., 2007; Karnoub et al., 2004). These data reveal that the Rac1 plays essential roles in the developments and pathogenicity of plant pathogenic fungi.
The pepper anthracnose fungus, Colletotrichum scovillei, causes severe losses of pepper fruit production in the tropical and temperate zones. RAC1 is a highly conserved small GTP-binding protein in the Rho GTPase family. This protein has been demonstrated to play a role in fungal development, and pathogenicity in several plant pathogenic fungi. However, the functional roles of RAC1 are not characterized in C. scovillei causing anthracnose on pepper fruits. Here, we generated a deletion mutant (ΔCsrac1) via homologous recombination to investigate the functional roles of CsRAC1. The ΔCsrac1 showed pleiotropic defects in fungal growth and developments, including vegetative growth, conidiogenesis, conidial germination and appressorium formation, compared to wild-type. Although ΔCsrac1 was able to develop appressoria, it failed to differentiate appressorium pegs. However, ΔCsrac1 still caused anthracnose disease with significantly reduced rate on wounded pepper fruits. Further analyses revealed that ΔCsrac1 was defective in tolerance to oxidative stress and suppression of host-defense genes. Taken together, our results suggest that CsRAC1 plays essential roles in fungal development and pathogenicity in C. scovillei-pepper fruit pathosystem.
In this study, we set out to investigate the functional roles of CsRAC1 in the pepper fruit anthracnose fungus C. scovillei using a targeted gene deletion mutant ΔCsrac1. Deletion of CsRAC1 resulted in pleiotropic defects in mycelial growth, conidiation, conidium morphology, conidial germination, and appressorium formation, compared to wild-type. ΔCsrac1 failed to form appressorium pegs, even though it was able to differentiate appressoria. However, ΔCsrac1 still caused anthracnose disease with significantly reduced rate on wounded pepper fruits, which may be caused by defects in tolerance to oxidative stress and suppression of host-defense gene. Taken together, our results suggested that CsRAC1 is important for fungal growth, development, and pathogenicity in C. scovillei-pepper fruit pathosystem.

Materials and Methods

Fungal strains, culture conditions

In this study, Colletotrichum scovillei wild-type strain KC05 and its transformants were routinely incubated on oatmeal agar (OMA; 50 g oatmeal and 15 g agar powder per liter) at 25°C with continuous light (Fu et al., 2021). Mycelia for extraction of genomic DNA and total RNA were grown in liquid complete media (CM, 10 g sucrose, 6 g casamino acid, and 6 g yeast extract per liter) for 2 days at 25°C with agitation (150 rpm) (Han et al., 2018). Fungal transformants were grown on transformation agar (TB3 agar, 200 g sucrose, 3 g casamino acid, 3 g yeast extract, 10 g glucose, and 8 g agar powder per liter) (Shin et al., 2019).

Phylogenetic analysis and sequence alignment

The sequences of CsRAC1 and its homologs were downloaded from National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov) and Comparative Fungal Genomics Platform (CFGP, http://cfgp.riceblast.snu.ac.kr) (Fu et al., 2019). Phylogenetic relationship among CsRAC1 and others Rho GTPases were analyzed using MEGA 7.0 software. The identities between CsRAC1 and its homologs were analyzed using NCBI BLASTP (https://blast.ncbi.nlm.nih.gov/). Domain structures were predicted using InterPro Scan (http://www.ebi.ac.uk/interpro/), and visualized using Illustrator for Biological Sequences, version 1.0.3. Primers were designed using Primer Quest Design Tool (http://sg.idtdan.com/site).

Targeted deletion of CsRAC1 and generation of complemented strain

Targeted deletion constructs were generated according to a modified double joint PCR (Yu et al., 2004). Each segment (1.5 kb) corresponding to up-stream and downstream of CsRAC1, was amplified using the primers 5F/5R and 3F/3R (Table 1). The HPH cassette, used for selection marker, was amplified using the primers HPHF/HPHR from pBCATPH (Choi et al., 2009). Those three amplified PCR products were fused and amplified with the primers NF/NR (Table 1) to generate the deletion constructs. The protoplasts of wild-type C. scovillei were transformed with the deletion constructs. The obtained transformants were cultured on TB3 agar containing hygromycin B (Sigma, St. Louis, MO, USA). The transformants were then screened by using PCR the primers SF/ SR (Table 1). The target deletion mutants were confirmed by Southern blotting and reverse transcription polymerase chain reaction (RT-PCR). To generate a complemented strain (Csrac1c), the target gene was amplified from the wild-type C. scovillei genome with primers NF/NR (Table 1). The amplicons were co-introduced into the protoplasts of ΔCsrac1, with geneticin resistance gene amplified from pII99 vector with primers GenF/GenR (Han et al., 2015). Complemented strains were selected through screening PCR and confirmed by RT-PCR.

RNA isolation and gene expression analysis

Total RNA was extracted from fungal mycelia and infected pepper fruits using Easy-Spin (iNtRON Biotechnology, Seongnam, Korea). cDNA was synthesis using the SuperScript III First-strand Synthesis System (Invitrogen, Carlsbad, CA, USA) from the total RNA. To detect transcripts of CsRAC1 in the transformants, RT-PCR was performed in a 20 μl mixture containing 50 ng/μl cDNA, 20 U Pfu Plus DNA polymerase (Elpis Bio, Daejeon, Korea) and 10 pmol forward/reverse primers (Fu et al., 2019). The β-tubulin gene was used as a control (Table 1). To analyze the gene expression, quantitative RT-PCR (qRT-PCR) was performed in a 10 μl mixture containing 5 μl HiPi Real-Time PCR 2× Master Mix (Elpis Bio), cDNA (25 ng/μl), and 0.5 μl forward/reverse primers (10 pmol/μl), using StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The qRT-PCR was performed in three-independent experiments with two replicates per experiment.

Phenotypic characterization of mutants

Potato dextrose agar (PDA; 39 g of potato dextrose agar per liter) and minimal media agar (MMA; 30 g of sucrose, 2 g of NaNO3, 1 g of KH2PO4, 0.5 g of MgSO4·7H2O, 0.5 g of KCl, 20 g of agar and 0.1 ml trace element solution per liter) were used to investigate mycelia growth. Lactophenol blue was used to stain the mycelia. To evaluate mycelial growth under oxidative stress, mycelial agar plugs from MMA were inoculated onto complete medium agar (CMA; 10 g of sucrose, 6 g of yeast extract, 6 g of casamino acid, and 15 g of agar per liter) containing H2O2 and incubated without light for 5 days at 25°C. For conidiation assay, mycelial agar plugs from MMA were inoculated onto V8 agar (V8A; V8 juice 80 ml, 310 μl of 10 N NaOH, 15 g of agar per liter), and incubated for 5-day dark and 2-day light at 25°C. Conidia were harvested with 5 ml of distilled water and counted using hemocytometer. To evaluate conidial germination and appressorium formation, conidia from OMA cultures were harvested using 2 ml distilled water, and then filtered through three layers of Miracloth (Calbiochem, San Diego, CA). Conidial suspensions were centrifuged at 5,000 rpm for 10 min for three times. Drops (20 μl) of conidia suspensions (5 × 104/ml) were placed on the hydrophobic surface of coverslips, and incubated in a humid plastic box at 25°C. To investigate septation in mycelia, mycelial agar plugs from OMA were placed on the coverslips and incubated for 3 days in dark. The septa were stained with Calcofluor white (CFW), and observed using a fluorescent microscope (Carl Zeiss, Jena, Germany).

Pathogenicity assays

To perform plant infection assays, conidial suspension (5 × 105/ml) were inoculated onto intact and wounded pepper fruits, and incubated in a humid plastic box at 25°C for 7 and 5 days, respectively. To evaluate appressorium formation and penetration, and dendroid structure formation, conidia suspension (5 × 104/ml) were inoculated on intact pepper fruits, and incubated in humid plastic box at 25°C. The samples were sliced from infected pepper fruits with a razor and observed using a light microscope. All of experiments were performed in three-independent experiments with three replicates per experiment.

Results

Phylogenetic analysis, domain prediction, and targeted gene deletion

The phylogenetic analysis showed that CsRAC1 from C. scovillei and other Rho GTPases from Colletotrichum gloeosporioides, Magnaporthe oryzae, Claviceps purpurea, Talaromyces marneffei, Neurospora crassa, and U. maydis were divided into six clades, which are RHO1, RHO2, RHO3, RHO4, RAC1, and CDC42 clades (Fig. 1A). In the RAC1 clade, CsRAC1 was closely related to its homolog in C. gloeosporioides, but distantly related to its homolog in U. maydis. Domain predictions revealed that all RAC1 proteins in those fungi contain a small GTP-binding protein domain (IPR005225) (Fig. 1B), which includes five G motifs (G1 to G5) and two functional elements (switch I, switch II) (Fig. 1C). A NCBI BLASTP search indicated that CsRAC1 shares 98.49%, 94.47%, 95.68%, 87.76%, 84.62%, 76.80% sequence identity with EQB58834.1, XP_003721025.1, KAG6135690.1, XP_002152535.1, XP_964519.3, and XP_011386548.1 from C. gloeosporioides, M. oryzae, C. purpurea, T. marneffei, N. crassa, and U. maydis, respectively (Fig. 1C). These results suggest that CsRAC1 homologs are well-conserved in plant pathogenic fungi. To determine the role of CsRAC1, we generate a targeted gene deletion mutant (ΔCsrac1) via homologous replacement (Fig. 2A). ΔCsrac1 was confirmed by Southern blotting and RT-PCR (Fig. 2B and C). To verify that the phenotypes of ΔCsrac1 were caused by deletion of CsRAC1, we generated a complemented strain (Csrac1c), which was verified by RT-PCR (Fig. 2C).

Roles of CsRAC1 in mycelial growth and septation

To investigate the roles of CsRAC1 in vegetative growth, we measured the diameter of colony growth. The colony diameter of wild-type was 41.7 ± 0.6 mm and 35.3 ± 0.6 mm on PDA and MMA, respectively (Fig. 3A and B). however, ΔCsrac1 significantly reduced mycelial growth with colony diameters of 30.3 ± 0.6 mm on PDA and 26.0 ± 1.0 mm on MMA (Fig. 3A and B). ΔCsrac1 was found to show more densely branched mycelia, compare to wild-type (Fig. 3A). The defect of mycelial growth was recovered in the Csrac1c (Fig. 3A and B). These results suggest that CsRAC1 is involved in mycelial growth of C. scovillei. We next stained hyphae using CFW to observe their morphology and septation. The hyphal morphology of ΔCsrac1 was found to be indistinguishable, whereas the average distance of the hyphal compartments of ΔCsrac1 (25.1 ± 3.7 μm) was significantly shorter than that of wild-type (39.5 ± 7.7 μm) and Csrac1c (37.0 ± 5.2 μm) (Fig. 3C and D). These results suggest that CsRAC1 is involved in growth and septation of hyphae in C. scovillei.

Roles of CsRAC1 in conidiation and conidium morphology

To determine whether CsRAC1 is involved in conidiation, we counted the conidia produced by ΔCsrac1. The result showed that ΔCsrac1 produced significantly less conidia, compared to wild-type and Csrac1c (Fig. 4A), suggesting that CsRAC1 is associated with conidiation of C. scovillei. Notably, conidia produced by ΔCsrac1 exhibited abnormal shape, compared to the wild-type and Csrac1c (Fig. 4B and C). The ΔCsrac1 produced larger conidia with average length of 14.6 ± 2.8 μm, which is longer than that of wild-type (10.5 ± 1.5 μm) and Csrac1c (10.7 ± 1.6 μm). Furthermore, ΔCsrac1 conidia are one end acute, whereas the wild-type conidia are cylindrical to clavate shape (Fig. 4B). These results suggested that CsRAC1 plays important roles in conidiogenesis.

Roles of CsRAC1 in appressorium formation

Because appressorium development is prerequisite for anthracnose disease by C. scovillei (Fu et al., 2021), we investigated whether CsRAC1 is involved in appressorium development on the hydrophobic surface of coverslips. After 5 h, the germination rate of wild-type was 77.3 ± 1.2%, whereas only 22.7 ± 3.1% of ΔCsrac1 conidia formed germ tube (Fig. 5). The defect in conidial germination was recovered in the Csrac1c. After 16 h, 92.7 ± 2.1% and 92.3 ± 2.1% conidia of wild-type and Csrac1c differentiated appressoria, respectively (Fig. 5). However, the appressorium formation rate was 42.3 ± 5.5%. These results suggest that CsRAC1 is involved in conidial germination and appressorium formation of C. scovillei.

Roles of CsRAC1 in anthracnose development

To determine the role of CsRAC1 in anthracnose development, we inoculated conidial suspensions onto intact pepper fruits. The ΔCsrac1 was non-pathogenic, whereas the wild-type and Csrac1 caused severe anthracnose disease after 7 days (Fig. 6A). This suggests that CsRAC1 is essential for pathogenicity of C. scovillei. We further inoculated conidial suspensions onto wounded pepper fruits. The ΔCsrac1 was found to induce anthracnose disease with recued rate, compared to the wild-type and Csrac1c (Fig. 6A), suggesting that CsRAC1 is involved in post-infection of C. scovillei. To investigate the role of CsRAC1 in penetration, we inoculated conidial suspensions onto intact pepper fruits. The result showed that the wild-type and Csrac1c successfully penetrated and induced dendroid structures in host cuticles (Fig. 6B). However, although ΔCsrac1 developed appressoria, it failed to penetrate (Fig. 6B). These results suggested that CsRAC1 is important for penetration and post-infection of C. scovillei.

Roles of CsRAC1 in tolerance to oxidative stress and suppression of host-defense genes

In fungal-plant interactions, pathogens experience oxidative stress due to reactive oxygen species produced by plant (Segal and Wilson, 2018). To test whether CsRAC1 is involved in tolerance to oxidative stress, we evaluated mycelial growth on CMA containing 20 mM H2O2. The inhibition rate of mycelial growth was 67.2 ± 2.0% in ΔCsrac1, compared to 52.2 ± 2.6% in wild-type and 51.3 ± 2.1% in Csac1c (Fig. 7A and B). This suggested that CsRAC1 contributes to tolerance to oxidative stress. We further evaluated expressions of host-defense genes in wounded pepper fruits infected by ΔCsrac1. Result showed that expression levels of CaPAL1 and CaHIR1 were greatly increased in pepper fruits infected by ΔCsrac1, compared that by wild-type and Csrac1c (Fig. 7C).

Discussion

Anthracnose disease caused by the genus Colletotrichum leads to a huge economic loss worldwide (Cannon et al., 2012). Although the foliar anthracnose by several Colletotrichum species, including C. orbiculare, C. gloeosporioides, C. higginsianum, and C. graminicola, have been extensively studied (Gan et al., 2013; Irieda et al., 2019; O’Connell et al., 2012), the molecular mechanisms underlying Colletotrichum-fruits interaction are still unknown (Fu et al., 2021). Therefore, we initiated functional genomics research on a pepper fruit anthracnose fungus C. scovillei (Fu et al., 2021; Han et al., 2016; Shin et al., 2019). Different to many other fungal pathogens which directly penetrate to the host cuticle layer, C. scovillei firstly penetrates the host wax layer and then developed highly branched hyphae in the cuticle layer, with an appearance of a dendroid structure (Fu et al., 2021). To study the anthracnose development on pepper fruits by C. scovillei, we decided to study a small GTPase RAC1, which was demonstrated to play important roles in fungal morphological development and appressorium-mediated penetration in several plant pathogenic fungi (Chen et al., 2008; Mahlert et al., 2006; Nesher et al., 2011; Rolke and Tudzynski, 2008; Tian et al., 2015; Virag et al., 2007). To investigate the CsRAC1, we firstly preformed analysis of phylogenetic relationship and domain prediction, which implicated that amino acid sequences of RAC1 GTPases are conserved among evolutionarily distant fungi.
Targeted deletion of CsRAC1 resulting in a mutant (ΔCsrac1) significantly reduced mycelial growth on nutrient-rich and -depleted medium (Fig. 3A and B). Further analysis of hyphal septation indicated that distance between hyphal compartments is significantly shorter than that of wild-type and Csrac1c (Fig. 3C and D). These results suggest that CsRAC1 is involved in hyphal growth and septation. Consistently, the association between the RAC1 GTPase and fungal growth was reported previously (Chen et al., 2008; Tian et al., 2015). In M. grisea, the Mgrac1 deletion mutant exhibited reduced mycelial growth, frequent branching, and curly tips in mycelia (Chen et al., 2008). In U. maydis, GTP-bound Rac1 was suggested to activate Cla4 to trigger cell wall extension at hyphal tip (Mahlert et al., 2006).
Deletion of CsRAC1 caused defects in fungal developments of C. scovillei. The ΔCsrac1 was significantly defective in conidiation, compared to the wild-type (Fig. 4), suggesting that CsRAC1 is associated with conidiation of C. scovillei. Notably, the conidia produced by ΔCsrac1 were morphologically abnormal, compared to that of wild-type (Fig. 4). Defect in conidiation was also found in deletion of Rac1 homologs in M. grisea and V. dahliae (Chen et al., 2008; Tian et al., 2015). The conidia produced by Rac1 deletion mutant in M. grisea and V. dahliae were elongated and round shape, respectively (Chen et al., 2008; Tian et al., 2015). These data suggest that CsRAC1 homologs play critical roles in conidiation. Our further analysis revealed that the abnormally-shaped conidia from ΔCsrac1 were reduced in conidial germination and appressorium formation in response to a hydrophobic surface (Fig. 5). Moreover, the appressoria generated by ΔCsrac1 conidia were larger in size, compared to those of wild-type (Fig. 5). Considering that RAC1 GTPase triggers reorganization of actin cytoskeleton (Moldovan et al., 1999), the CsRAC1 may regulate actin dynamics during appressorium development in C. scovillei.
Deletion of CsRAC1 significantly reduced capability to cause anthracnose on pepper fruits. ΔCsrac1 was completely defective in appressorium-mediated penetration (Fig. 6A and B). Although the appressoria formed by ΔCsrac1 were normal in morphology, they were unable to penetrate host cuticle (Fig. 6B). Previous studies revealed that the RAC1 functions to activate NOX complex (Chen et al., 2008; Ryder et al., 2013). During appressorium development, the NOX generates reactive oxygen species, which is involved in appressorium peg formation via remodeling septin-mediated cytoskeleton (Kim and Hwang, 2014). The ΔCsrac1 caused significantly recued lesions on wounded pepper fruits (Fig. 6A). Interestingly, the deletion mutant of CgRac1 in C. gloeosporioides abolished plant infection in wounded host cells (Nesher et al., 2011). We speculate that CsRAC1 homologs may be involved in suppression of host-defense mechanism. This hypothesis is supported by significantly upregulation of two host-defense genes (CaPAL1 and CaHIR1) in host tissues infected by ΔCsrac1, compared to wild-type (Fig. 7B). The CaPAL1 (phenylalanine ammonia-lyase) is known to play a role in salicylic acid-dependent signaling pepper in response to pathogens (Kim and Hwang, 2014). The CaHIR1 (hypersensitive induced reaction) positively regulates hypersensitive response cell death in plant infection (Jung and Hwang, 2007). We further tested mycelial growth in CMA containing H2O2 and found that ΔCsrac1 was more sensitive than wild-type under oxidative stress (Fig. 7A). These results reveal the fundamental roles of CsRAC1 in anthracnose development of C. scovillei.
In summary, we characterized the functional roles of CsRAC1 in pepper fruit anthracnose fungus C. scovillei. Deletion of CsRAC1 caused pleiotropic defects in most stages of fungal growth, developments, and pathogenicity, including mycelial growth, conidiation, conidium morphology, conidial germination, appressorium formation, appressorium penetration, and post-infection of C. scovillei. These results suggest that CsRAC1 plays essential roles in fungal growth, development, and pathogenicity during anthracnose by C. scovillei. Our results contribute to a better understanding of anthracnose disease development on fruits.

Acknowledgments

This study was supported by a research grant of Kangwon National University in 2018.

Notes

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Fig. 1
Phylogenetic analysis, domain prediction, and sequence alignment. (A) Phylogenetic analysis of Rho GTPases in different fungi. The phylogentic tree was generated by neighbor-joining method with 1,000 boot straps using MEGA 7.0 software. (B) Domain prediction of CsRAC1 homologs in different fungi. Domian rediction using InterProScan revealed that all proteins contain a small GTP-binding protein domain (IPR005225). (C) Sequnece alignment of small GTP-binding protein domain among CsRAC1 homologs. The conserved amino acid sequences were marked with black shadow. The small GTP-binding protein domain contains conserved motifs, including switch I, switch II, G1, G2, G3, G4, and G5.
ppj-oa-09-2021-0140f1.jpg
Fig. 2
Targeted gene deletion and verification of deletion mutant. (A) Targeted deletion of CsRAC1. The CsRAC1 was replaced using HPH cassette via homologous recombination. (B) Verification of CsRAC1 deletion using Southern blotting. Genomic DNA of wild-type and candidate mutants was digested with Nco I and hybridized to a specific probe. (C) Expresison of CsRAC1 in deletion mutant. Expresion of CsRAC1 was confirmed using reverse transcription polymerase chain reaction.
ppj-oa-09-2021-0140f2.jpg
Fig. 3
Roles of CsRAC1 in mycelial growth and septation. (A, B) Evaluation of mycelial growth on potato dextrose agar (PDA) and minimal media agar (MMA). (A) Photographs of mycelail growth and hyphal tips were taken after 5 days. Scale bars = 20 μm. (B) Colony diameter was measured after 5 days. (C, D) Observation of septation in mycelia. (C) The mycelial septa were stained with Calcofluor white (CFW). DIC, differential interference contrast. (D) The average distance between septa was measured at least 50 mycelial compartments. Scale bars = 20 μm. Significant difference (*) was analyzed by Duncan’s test (P < 0.05).
ppj-oa-09-2021-0140f3.jpg
Fig. 4
Roles of CsRAC1 in conidiogenesis. (A) Quantitative evaluation of conidiation. Conidia were collected with 5 ml of distilled water from 7-day-old oatmeal agar (OMA). (B) Observation of conidium morphology. The conidia were collected from 7-day-old OMA. Scale bars = 20 μm. (C) Measurement of conidium length. The average length of conidia were measued from at least 50 conidia, collected from 7-day-old OMA. Significant difference (*) was analyzed by Duncan’s test (P < 0.05).
ppj-oa-09-2021-0140f4.jpg
Fig. 5
Roles of CsRAC1 in conidial germination and appressorium formation on hydrophobic surface. (A) Observation of appressium formation. Photographs of appressoria were taken after 16 h. Scale bars = 10 μm. (B) Evaluation of conidial germination and appressorium formation. Conidia obtained from 7-day-old oatmeal agar were placed on the hydrophobic surface of coverlsips and incubated for 10 h for germination and 16 h for appressorium formation. Significant difference (*) was analyzed by Duncan’s test (P < 0.05).
ppj-oa-09-2021-0140f5.jpg
Fig. 6
Roles of CsRAC1 in anthrcnose development. (A) Pathogenicity assays. Conidial suspensions were inoculated onto intact and wounded pepper frutis, and incubated in a humid plastic box at 25ºC. Photographs of intact and wounded pepper fruits were taken after 7 and 5 days, respectively. (B) Observation of penetration. The photographs were taken after 3 days. CO, AP, and DS indicates conidium, appressorium, and dendroid structure, respectively. Scale bars = 20 μm.
ppj-oa-09-2021-0140f6.jpg
Fig. 7
Rols of CsRAC1 in tolerence to oxidative stress and expression of host-defense genes. (A, B) Mycelial growh on CMA contianing 20 mM H2O2. (A) The photogrpahs were taken after 5 days. (B) Inhibition rate of mycelial growth was evaluated after 5 days. (C) Expresion of host-defense genes. Total RNA was extracted from wounded pepper frutis infected by wild-type and ΔCsrac1 after 16 h.
ppj-oa-09-2021-0140f7.jpg
Table 1
Primers used in this study
Primer Sequence (5′→ 3′)
CsRAC1
 5F CTTCCGTTGCCTTGACTTCTATTGC
 5R CCTCCACTAGCTCCAGCCAAGCCTTGGAGGGACAAGGAGAATTG
 3F GTTGGTGTCGATGTCAGCTCCGGAGAACATTTGGATTGGCGTTCAG
 3R GAAGACGGAGAAGAAGGACAAA
 NF GCTTGGTCTGGTCTGTCTTC
 NR CTCCATCAACGCCCACTT
 SF TTGACTCTCTCGCCTACCTTA
 SR TCTTTGTGAGAGTGAGTGCTATC
 RTF GTCTGGGACTTTGGGATACTG
 RTR GAGGGACTCAAGGGTGTTG
 PF TTTCCCACCACCTTCAACAC
 PR GGTTCCGATGGCTGCATAAA
Hygromicin phophotransferase
 HPH_F GGCTTGGCTGGAGCTAGTGGAGG
 HPH_R CTCCGGAGCTGACATCGACACCAAC
Capsicum annuum defense genes
 CaActin_F AAGCTCTCCTTTGTTGCTGTT
 CaActin_R GACTTCTGGGCATCTGAATCT
 CaHIR1_F GACAAAGCTAATGAAGCATTCTAC
 CaHIR1_R GGTGTCGAAGTACTGGGTTACC
 CaLRR1_F GAATGCAACTCCGAAGGG
 CaLRR1_R CTGATAATCTATTACTATTCAATCTCA
 CaPAL1_F GGTTTTGGTGCAACATCACATAGGAG
 CaPAL1_R ATTGTCAAAGTTCTCTTAGCTACTTGGC
 CaPik1_F GGCTCTTGGTTCACTGGAAGATCATCTA
 CaPik1_R GCACAGTATCCATATGTACCCATCACTCTG
 CaPR1_F CAGGATGCAACACTCTGGTGG
 CaPR1_R ATCAAAGGCCGGTTGGTC

References

Ali, A, Bordoh, PK, Singh, A, Siddiqui, Y and Droby, S 2016. Post-harvest development of anthracnose in pepper (Capsicum spp): etiology and management strategies. Crop Prot. 90:132-141.
crossref
Barthelmes, K, Ramcke, E, Kang, H-S, Sattler, M and Itzen, A 2020. Conformational control of small GTPases by AM-Pylation. Proc Natl Acad Sci U S A. 117:5772-5781.
crossref pmid pmc
Caires, NP, Pinho, DB, Souza, J, Silva, MA, Lisboa, DO, Pereira, OL and Furtado, GQ 2014. First report of anthracnose on pepper fruit caused by Colletotrichum scovillei in Brazil. Plant Dis. 98:1437.
crossref
Cannon, PF, Damm, U, Johnston, PR and Weir, BS 2012. Colletotrichum: current status and future directions. Stud Mycol. 73:181-213.
crossref pmid pmc
Chen, J, Zheng, W, Zheng, S, Zhang, D, Sang, W, Chen, X, Li, G, Lu, G and Wang, Z 2008. Rac1 is required for pathogenicity and Chm1-dependent conidiogenesis in rice fungal pathogen Magnaporthe grisea . PLoS Pathog. 4:e1000202.
crossref pmid pmc
Cherfils, J and Zeghouf, M 2013. Regulation of small GTPases by GEFs, GAPs, and GDIs. Physiol Rev. 93:269-309.
crossref pmid
Choi, J, Kim, Y, Kim, S, Park, J and Lee, Y-H 2009. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae . Fungal Genet Biol. 46:243-254.
crossref pmid
Egan, MJ, Wang, Z-Y, Jones, MA, Smirnoff, N and Talbot, NJ 2007. Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proc Natl Acad Sci U S A. 104:11772-11777.
crossref pmid pmc
Food and Agriculture Organization of the United Nations 2021 FAOSTAT. URL http://www.fao.org/faostat/en/#data/QC/visualize . 3 November 2021.
Fu, T, Han, J-H, Shin, J-H, Song, H, Ko, J, Lee, Y-H, Kim, K-T and Kim, KS 2021. Homeobox transcription factors are required for fungal development and the suppression of host defense mechanisms in the Colletotrichum scovilleipepper pathosystem. mBio. 12:e0162021.
crossref pmid pdf
Fu, T, Kim, J-O, Han, J-H, Gumilang, A, Lee, Y-H and Kim, KS 2018. A small GTPase RHO2 plays an important role in pre-infection development in the rice blast pathogen Magnaporthe oryzae . Plant Pathol J. 34:470-479.
crossref pmid pmc
Fu, T, Park, G-C, Han, JH, Shin, J-H, Park, H-H and Kim, KS 2019. MoRBP9 encoding a ran-binding protein microtubule-organizing center is required for asexual reproduction and infection in the rice blast pathogen Magnaporthe oryzae . Plant Pathol J. 35:564-574.
crossref pmid pmc
Gan, P, Ikeda, K, Irieda, H, Narusaka, M, O’Connell, RJ, Narusaka, Y, Takano, Y, Kubo, Y and Shirasu, K 2013. Comparative genomic and transcriptomic analyses reveal the hemibiotrophic stage shift of Colletotrichum fungi. New Phytol. 197:1236-1249.
crossref pmid
Giacomin, RM, de Fátima Ruas, C, Moreira, AFP, Guidone, GHM, Baba, VY, Rodrigues, R and Gonçalves, LSA 2020. Inheritance of anthracnose resistance (Colletotrichum scovillei) in ripe and unripe Capsicum annuum fruits. J Phytopathol. 168:184-192.
crossref
Gong, T, Liao, Y, He, F, Yang, Y, Yang, D-D, Chen, X-D and Gao, X-D 2013. Control of polarized growth by the Rho family GTPase Rho4 in budding yeast: requirement of the N-terminal extension of Rho4 and regulation by the Rho GTPase-activating protein Bem2. Eukaryot Cell. 12:368-377.
crossref pmid pmc
Han, J-H, Chon, J-K, Ahn, J-H, Choi, I-Y, Lee, Y-H and Kim, KS 2016. Whole genome sequence and genome annotation of Colletotrichum acutatum, causal agent of anthracnose in pepper plants in South Korea. Genom Data. 8:45-46.
crossref pmid pmc
Han, J-H, Lee, H-M, Shin, J-H, Lee, Y-H and Kim, KS 2015. Role of the MoYAK1 protein kinase gene in Magnaporthe oryzae development and pathogenicity. Environ Microbiol. 17:4672-4689.
crossref pmid
Han, J-H, Shin, J-H, Lee, Y-H and Kim, KS 2018. Distinct roles of the YPEL gene family in development and pathogenicity in the ascomycete fungus Magnaporthe oryzae . Sci Rep. 8:14461.
crossref pmid pmc pdf
Harris, SD 2011. Cdc42/Rho GTPases in fungi: variations on a common theme. Mol Microbiol. 79:1123-1127.
crossref pmid
Irieda, H, Inoue, Y, Mori, M, Yamada, K, Oshikawa, Y, Saitoh, H, Uemura, A, Terauchi, R, Kitakura, S, Kosaka, A, Singkaravanit-Ogawa, S and Takano, Y 2019. Conserved fungal effector suppresses PAMP-triggered immunity by targeting plant immune kinases. Proc Natl Acad Sci U S A. 116:496-505.
crossref pmid
Jung, HW and Hwang, BK 2007. The leucine-rich repeat (LRR) protein, CaLRR1, interacts with the hypersensitive induced reaction (HIR) protein, CaHIR1, and suppresses cell death induced by the CaHIR1 protein. Mol Plant Pathol. 8:503-514.
crossref pmid
Karnoub, AE, Symons, M, Campbell, SL and Der, CJ 2004. Molecular basis for Rho GTPase signaling specificity. Breast Cancer Res Treat. 84:61-71.
crossref pmid
Khalimi, K, Darmadi, AAK and Suprapta, DN 2019. First report on the prevalence of Colletotrichum scovillei associated with anthracnose on chili pepper in Bali, Indonesia. Int J Agric Biol. 22:363-368.
crossref
Kim, DS and Hwang, BK 2014. An important role of the pepper phenylalanine ammonia-lyase gene (PAL1) in salicylic acid-dependent signalling of the defence response to microbial pathogens. J Exp Bot. 65:2295-2306.
crossref pmid pmc
Kim, S, Park, M, Yeom, S-I, Kim, Y-M, Lee, JM, Lee, H-A, Seo, E, Choi, J, Cheong, K, Kim, K-T, Jung, K, Lee, G-W, Oh, S-K, Bae, C, Kim, S-B, Lee, H-Y, Kim, S-Y, Kim, M-S, Kang, B-C, Jo, YD, Yang, H-B, Jeong, H-J, Kang, W-H, Kwon, J-K, Shin, C, Lim, JY, Park, JH, Huh, JH, Kim, J-S, Kim, B-D, Cohen, O, Paran, I, Suh, MC, Lee, SB, Kim, Y-K, Shin, Y, Noh, S-J, Park, J, Seo, Y-S, Kwon, S-Y, Kim, HA, Park, JM, Kim, H-J, Choi, S-B, Bosland, PW, Reeves, G, Jo, S-H, Lee, B-W, Cho, H-T, Choi, H-S, Lee, M-S, Yu, Y, Choi, YD, Park, B-S, van Deynze, A, Ashrafi, H, Hill, T, Kim, WT, Pai, H-S, Ahn, HK, Yeam, I, Giovannoni, JJ, Rose, JKC, Sørensen, I, Lee, S-J, Kim, RW, Choi, I-Y, Choi, B-S, Lim, J-S, Lee, Y-H and Choi, D 2014. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat Genet. 46:270-278.
crossref pmid
Liao, C-Y, Chen, M-Y, Chen, Y-K, Kuo, K-C, Chung, K-R and Lee, M-H 2012. Formation of highly branched hyphae by Colletotrichum acutatum within the fruit cuticles of Capsicum spp. Plant Pathol. 61:262-270.
crossref
Mahlert, M, Leveleki, L, Hlubek, A, Sandrock, B and Bölker, M 2006. Rac1 and Cdc42 regulate hyphal growth and cytokinesis in the dimorphic fungus Ustilago maydis. Mol Microbiol. 59:567-578.
crossref pmid
Moldovan, L, Irani, K, Moldovan, NI, Finkel, T and Goldschmidt-Clermont, PJ 1999. The actin cytoskeleton reorganization induced by Rac1 requires the production of superoxide. Antioxid Redox Signal. 1:29-43.
crossref pmid
Nesher, I, Minz, A, Kokkelink, L, Tudzynski, P and Sharon, A 2011. Regulation of pathogenic spore germination by CgRac1 in the fungal plant pathogen Colletotrichum gloeosporioides. Eukaryot Cell. 10:1122-1130.
crossref pmid pmc
O’Connell, RJ, Thon, MR, Hacquard, S, Amyotte, SG, Kleemann, J, Torres, MF, Damm, U, Buiate, EA, Epstein, L, Alkan, N, Altmüller, J, Alvarado-Balderrama, L, Bauser, CA, Becker, C, Birren, BW, Chen, Z, Choi, J, Crouch, JA, Duvick, JP, Farman, MA, Gan, P, Heiman, D, Henrissat, B, Howard, RJ, Kabbage, M, Koch, C, Kracher, B, Kubo, Y, Law, AD, Lebrun, M-H, Lee, Y-H, Miyare, I, Moore, N, Neumann, U, Nordström, K, Panaccione, DG, Panstruga, R, Place, M, Proctor, RH, Prusky, D, Rech, G, Reinhardt, R, Rollins, JA, Rounsley, S, Schardl, CL, Schwartz, DC, Shenoy, N, Shirasu, K, Sikhakolli, UR, Stüber, K, Sukno, SA, Sweigard, JA, Takano, Y, Takahara, H, Trail, F, van der Does, HC, Voll, LM, Will, I, Young, S, Zeng, Q, Zhang, J, Zhou, S, Dichman, MB, Schulze-Lefert, P, Ver Loren van Themaat, E, Ma, LJ and Vaillancourt, LJ 2012. Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses. Nat Genet. 44:1060-1065.
crossref pmid pmc
Oo, MM, Lim, G, Jang, HA and Oh, S-K 2017. Characterization and pathogenicity of new record of anthracnose on various chili varieties caused by Colletotrichum scovillei in Korea. Mycobiology. 45:184-191.
crossref pmid pmc
Oo, MM and Oh, S-K 2016. Chilli anthracnose (Colletotrichum spp.) disease and its management approach. Korean J Agric Sci. 43:153-162.
crossref
Peres, NA, Timmer, LW, Adaskaveg, JE and Correll, JC 2005. Lifestyles of Colletotrichum acutatum . Plant Dis. 89:784-796.
crossref pmid
Robinson, NGG, Guo, L, Imai, J, Toh-e, A, Matsui, Y and Tamanoi, F 1999. Rho3 of Saccharomyces cerevisiae, which regulates the actin cytoskeleton and exocytosis, is a GTPase which interacts with Myo2 and Exo70. Mol Cell Biol. 19:3580-3587.
crossref pmid pmc
Rolke, Y and Tudzynski, P 2008. The small GTPase Rac and the p21-activated kinase Cla4 in Claviceps purpurea: interaction and impact on polarity, development and pathogenicity. Mol Microbiol. 68:405-423.
crossref pmid
Ryder, LS, Dagdas, YF, Mentlak, TA, Kershaw, MJ, Thornton, CR, Schuster, M, Chen, J, Wang, Z and Talbot, NJ 2013. NADPH oxidases regulate septin-mediated cytoskeletal remodeling during plant infection by the rice blast fungus. Proc Natl Acad Sci U S A. 110:3179-3184.
crossref pmid pmc
Schmidt, A, Bickle, M, Beck, T and Hall, MN 1997. The yeast phosphatidylinositol kinase homolog TOR2 activates RHO1 and RHO2 via the exchange factor ROM2. Cell. 88:531-542.
crossref pmid
Segal, LM and Wilson, RA 2018. Reactive oxygen species metabolism and plant-fungal interactions. Fungal Genet Biol. 110:1-9.
crossref pmid
Shin, J-H, Han, J-H, Park, H-H, Fu, T and Kim, KS 2019. Optimization of polyethylene glycol-mediated transformation of the pepper anthracnose pathogen Colletotrichum scovillei to develop an applied genomics approach. Plant Pathol J. 35:575-584.
crossref pmid pmc
Smithers, CC and Overduin, M 2016. Structural mechanisms and drug discovery prospects of Rho GTPases. Cells. 5:26.
crossref pmid pmc
Tian, H, Zhou, L, Guo, W and Wang, X 2015. Small GTPase Rac1 and its interaction partner Cla4 regulate polarized growth and pathogenicity in Verticillium dahliae . Fungal Genet Biol. 74:21-31.
crossref pmid
Toporek, SM and Keinath, AP 2020. First report of Colletotrichum scovillei causing anthracnose fruit rot on pepper in South Carolina, United States. Plant Dis. 105:1222.
crossref
Van Aelst, L and D'Souza-Schorey, C 1997. Rho GTPases and signaling networks. Genes Dev. 11:2295-2322.
crossref pmid
Virag, A, Lee, MP, Si, H and Harris, SD 2007. Regulation of hyphal morphogenesis by cdc42 and rac1 homologues in Aspergillus nidulans . Mol Microbiol. 66:1579-1596.
crossref pmid
Yoshida, S, Bartolini, S and Pellman, D 2009. Mechanisms for concentrating Rho1 during cytokinesis. Genes Dev. 23:810-823.
crossref pmid pmc
Yu, J-H, Hamari, Z, Han, K-H, Seo, J-A, Reyes-Domínguez, Y and Scazzocchio, C 2004. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol. 41:973-981.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next