Plant Pathol J > Volume 40(4); 2024 > Article
Lee, Kim, and Hong: Light- and Relative Humidity-Regulated Hypersensitive Cell Death and Plant Immunity in Chinese Cabbage Leaves by a Non-adapted Bacteria Xanthomonas campestris pv. vesicatoria

Abstract

Inoculation of Chinese cabbage leaves with high titer (107 cfu/ml) of the non-adapted bacteria Xanthomonas campestris pv. vesicatoria (Xcv) strain Bv5-4a.1 triggered rapid leaf tissue collapses and hypersensitive cell death (HCD) at 24 h. Electrolyte leakage and lipid peroxidation markedly increased in the Xcv-inoculated leaves. Defence-related gene expressions (BrPR1, BrPR4, BrChi1, BrGST1 and BrAPX1) were preferentially activated in the Xcv-inoculated leaves. The Xcv-triggered HCD was attenuated by continuous light but accelerated by a dark environment, and the prolonged high relative humidity also alleviated the HCD. Constant dark and increased relative humidity provided favorable conditions for the Xcv bacterial growth in the leaves. Pretreated fluridone (biosynthetic inhibitor of endogenous abscisic acid [ABA]) increased the HCD in the Xcv-inoculated leaves, but exogenous ABA attenuated the HCD. The pretreated ABA also reduced the Xcv bacterial growth in the leaves. These results highlight that the onset of HCD in Chinese cabbage leaves initiated by non-adapted pathogen Xcv Bv5-4a.1 and in planta bacterial growth was differently modulated by internal and external conditional changes.

Plants have developed sophisticated defense mechanisms against pathogen attacks, and non-host disease resistance (NHR) is known as a primary native barrier conferring durable and sustainable plant protection against a broad range of would-be pathogen (Fonseca and Mysore, 2019; Lee et al., 2016; Senthil-Kumar and Mysore, 2013; Uma et al., 2011). The NHR has been reported in many plants to diverse non-adapted fungi, bacteria and viruses, showing distinct features. Fungi Blumeria graminis causing powdery mildew on several cereal crops were highly differentiated by their hosts, wheat and barley (Delventhal et al., 2017). B. graminis f.sp. tritici infects wheat but not barley, and vice versa. Germinated spores of wheat rust fungus Puccinia triticina could form appressoria on the surfaces of non-host rice leaves, but infection hyphae and appressoria were fragmented and followed by halted further fungal invasion (Li et al., 2017a). Spraying Xanthomonas citri caused citrus canker in lemon (Citrus limon) leaves, but X. campestris pv. campestris (Xcc), black rot bacteria in cruciferous plants, could not induce any phenotypic change in lemon leaves by the same inoculation procedure (Chiesa et al., 2019). X. citri consistently grew in the host lemon leaves during the canker pathogenesis, but Xcc growth was limited in the non-host leaves over time. Pseudomonas syringae pv. tomato (Pst) bacteria proliferated within the host tomato leaves, but P. syringae pv. tabaci growth was significantly suppressed in non-host tomato plants (Lee et al., 2013). Tomato mosaic virus multiplied in the host tomato leaves, but viral replication of non-adapted pathogens Tobacco mild green mosaic virus and Pepper mild mottle virus was highly arrested (Ishibashi et al., 2009).
Hypersensitive cell death (HCD) found in one type of NHR was not observed in another class (Mysore and Ryu, 2004). Highly localized cell death appeared in non-host pepper leaves by Phytophthora infestans zoospores (Lee et al., 2014). HCD has been frequently developed in plant tissues against non-adapted bacteria. Infiltration of soybean bacterial pustule pathogen X. axonopodis (formerly campestris) pv. glycines (Xag) caused HCD in non-host pepper and tomato leaves, whilst tobacco leaves inoculated by the same non-adapted Xag strain did not show HCD (Oh et al., 1999, 2006). Infiltrating Xcc (108 cfu/ml) into the mesophyll tissues of non-host pepper leaves rapidly induced the visible HCD (Li et al., 2017b). Spraying a high Xcc dose (109 cfu/ml) or infiltrating (107 cfu/ml) induced microscopic cell death in the non-host C. limon leaves, but any symptom was not found macroscopically, which was quite different from no plant cell death by an adapted bacteria X. citri at the same time point (Chiesa et al., 2019). HCD occurrence and biochemical responses in NHR were similar to those in resistant plants against avirulent strain of adapted pathogens. Avirulent Pseudomonas syringae pv. tabaci and non-adapted P. syringae pv. maculicola (Psm) led to similar kinetics in HCD, Hsr203J and Hin1 gene expressions, and salicylic acid accumulation in tobacco leaves (Krzymowska et al., 2007). However, the establishment of HCD was not necessary to confer NHR all the time in Arabidopsis. NHR was found in Arabidopsis against a bean pathogen P. syringae pv. phaseolicola in the absence of HCD but in planta bacterial growth was highly suppressed (He et al., 2004; Lu et al., 2001). Interestingly, NHO1 gene expression in Arabidopsis without HCD in response to P. syringae pv. phaseolicola was similar to that mediated by an avirulent Pst harboring avrB protein triggering HCD (Kang et al., 2003).
During the establishment of HCD in NHR, various biochemical responses, such as defense-related gene expressions and antioxidant enzymes activities, have highly activated in plant tissues triggered by non-adapted pathogens compared to those mediated by adapted pathogen infections. Phenylalanine ammonia-lyase gene expression and callose deposition was distinguished in the C. limon leaves by non-adapted Xcc, but these responses were not elicited by adapted X. citri (Chiesa et al., 2019). Peroxidase and catalase activities were significantly higher in mung bean leaves inoculated by non-adapted X. hortorum pv. pelargonii than those by adapted X. hortorum pv. phaseoli (Farahani and Taghavi, 2016). In contrast, defense-related genes PR-4, PR-5 and PDF1.2 were drastically expressed in Arabidopsis leaves by an adapted pathogen Alternaria brassicicola, but a non-adapted A. alternata Japanese pear pathotype could not induce the gene expressions (Narusaka et al., 2005).
Plant disease resistance or cell death could be changed by ambient conditions in the plants. High relative humidity (RH) increased stomatal opening in Arabidopsis leaves compared to the usual RH, providing favorable conditions for Pst to enter the plant leaves through stomata and provoke disease symptoms (Panchal et al., 2016). Microscopic cell death in Arabidopsis leaves by an avirulent Psm carrying avrRpm1 was less developed without light illumination, and suppressed bacterial growth in planta in the incompatible interaction was alleviated under the dark environment (Zeier et al., 2004). Spontaneous cell death in Arabidopsis lesion mimic mutants cpn1-1 and ssi4 under low RH conditions were compromised by increasing RH (Jambunathan et al., 2001; Zhou et al., 2004). NHR-mediated HCD can also be altered under environmental changes such as temperature, RH and day-length (Ayliffe and Sørensen, 2019). Intensities of HR in tobacco leaves by non-adapted bacteria P. syringae pv. phaseolicola were highly dependent on temperature, and HCD in the tobacco leaves at 20°C was diminished at 30°C (Klement et al., 1999). Low soil moisture elevated HCD level in Arabidopsis leaves triggered by non-adapted P. syringae pv. tabaci (Choudhary et al., 2017).
Non-host resistance of Chinese cabbage plants has rarely been demonstrated so far. Chinese cabbage leaves inoculated by a non-adapted bacteria Pst showed HCD accompanying H2O2 accumulation at the inoculated site (Park et al., 2005). In our previous study, we have shown differential host and NHR of Chinese cabbage plants to bacterial inoculations of Xcc and X. campestris pv. vesicatoria (Xcv), respectively (Lee and Hong, 2012). HCD occurred in the leaves during the NHR, accompanying rapid accumulation of phenolic compounds and lipid peroxidation histochemically detected at the local infection site by the non-adapted Xcv strain Bv5-4a.1. The non-adapted bacterial growth within the leaves was significantly arrested. In this study, we demonstrated elevated oxidative stress and activation of defense-related gene expression during the HCD in the leaves against the non-adapted Xcv. Effects of light and high RH length on the Xcv-triggered HCD and in planta Xcv bacterial growth were investigated in association with abscisic acid (ABA) signaling, to see non-host plant immunity under changing environmental conditions.

Materials and Methods

Plant growth

Six Chinese cabbage seedlings (Brassica rapa var. pekinensis, cv. Tushim-eotgari) were grown in a square pot (12 cm × 8 cm × 5.5 cm) containing the steam-sterilized commercial soil mixture Toshil (coco peat 50%, peat moss 25%, perlite 10%, vermiculite 10% and zeolite 5%) (Shinan Growth Co., Ltd., Jinju, Korea) under controlled environmental conditions (25 ± 2°C, 70 μmole/m2/s illumination with a 12-h photoperiod, and 60% RH), as described previously (Kim et al., 2015). The Chinese cabbage seedling at the two-leaf stage were used for bacterial inoculation and chemical treatment.

Bacterial cultures and plant inoculation

The two bacterial strains 8004 and Bv5-4a.1 of Xanthomonas campestris pathovars were used in this study. Xcc strain 8004 causes typical susceptible disease symptoms in Chinese cabbage leaves (Lee and Hong, 2012, 2015). Xcv strain Bv5-4a.1, which is pathogenic to tomato plants, does not cause any disease symptoms as non-adapted bacteria in the Chinese cabbage plants as leaf clipping inoculation (Lee and Hong, 2012). The two bacterial strains were cultured overnight at 30°C in nutrient broth supplemented with 50 μg/ml of rifampicin, harvested by centrifugation at 10,000 ×g for 2 min, and resuspended in sterilized water. The bacterial suspensions were adjusted using a spectrophotometer. The primary leaves of the seedlings were inoculated by infiltrating the abaxial surfaces with bacterial suspensions using a needleless syringe.

Environmental changes in day length and high RH duration

Light and RH conditions were changed differently after Xcv bacterial inoculation to see the effects of day length and RH duration on the HCD and in planta growth of non-adapted Xcv. The standard day length for the 12-h illumination described above was initiated at 8:00 and regulated using a timer. The continuous light for 24-h illumination in plant growth shelves was also made using a timer but covered by a black curtain to not disturb dark conditions in other shelves for 12-h illumination in the same growth room. The continuous dark condition was offered by covering growth shelves with a black curtain.
The RH, ca. 60%, was maintained as a moderate RH in the growth room. The prolonged high RH for 8 h and 24 h was provided by transparent covers after the bacterial inoculation. The temperature in the plant shelves was tightly controlled to not be elevated owing to the transparent covers. Plants under the three different RH conditions were followed by standard day length for the 12-h illumination. Bacterial inoculation in all different environments was conducted at 9:00.

Evaluation of in planta bacterial growth

The in planta bacterial populations (cfu/cm2 leaf area) within the inoculated leaves were determined by plating serially diluted leaf macerates on the nutrient agar medium supplemented with rifampicin (50 μg/ml) as described previously (Lee and Hong, 2015). Bacteria colony forming unit (cfu) on the nutrient agar medium were counted at 2 days after incubation at 30°C.

Chemical treatment of plants

ABA (Sigma-Aldrich Co., St. Louis, MO, USA) and its biosynthesis inhibitor fluridone (Sigma-Aldrich Co.) were applied on the seedlings. ABA stock (10 mM) was prepared in ethanol, and 1% of ethanol was equally contained in different concentrations (0, 5, 10, 20, 50 and 100 μM) of ABA solution. Fluridone stock (20 mM) was prepared in methanol, and 0.5% of methanol was equally contained in different concentrations (0, 5, 10, 20, 50 and 100 μM) of fluridone solution. ABA and fluridone stocks were diluted in distilled water and the solutions were evenly sprayed onto the seedlings at 24 h before inoculation with bacteria.

Electrolytes leakage and lipid peroxidation in plant leaves

Electrolyte leakage from the bacteria-inoculated leaves was determined as described previously (Kim et al., 2015; Lee et al., 2022b). Leaf discs (1-cm in diameter) cut from the inoculated Chinese cabbage leaves were used for electrolyte leakage analyses. Plant cell death based on the electrolyte leakage from leaf tissues was quantified by measuring ion conductivity (Mackey et al., 2002). Four leaf discs were floated on the 10 ml of distilled water in 50-ml conical tube for 1 h. Ion conductivity was measured in the leaf disc-floated samples using a conductivity meter (Model EC-40N, iSTEK Inc., Seoul, Korea). The floating leaf discs in the tube were boiled for 15 min to elute total electrolytes from the leaf tissues. After being cooled down to room temperature, electrolyte leakage was re-measured. Relative electrolyte leakage in the leaf tissues is expressed as percentages of electrolyte leakage from the unboiled samples to those from the boiled samples.
Lipid peroxidation in the leaf tissues was investigated according to the procedure of Lee et al. (2022b). Four leaf discs (1-cm in diameter) cut from the inoculated leaves were macerated in a microtube using 600 μl of 0.1% trichloroacetic acid (TCA). After centrifugation at 15,000 ×g at 4°C for 15 min, 250 μl of supernatant was added to 1 ml of 0.5% thiobarbituric acid prepared in 20% TCA in 15-ml conical tube and then heated at 95°C for 30 min. The reaction was terminated in an ice bed, and the reaction mixture was transferred to a microtube for centrifugation at 15,000 ×g at 4°C for 15 min. Thiobarbituric acid reactive substances (TBARS) were measured spectrophotometrically at OD532 nm. TBARS amounts were corrected for non-specific absorption by subtracting values at OD600 nm, calculated using the extinction coefficient of 155/mM/cm, and expressed as nmole/g fresh weight (FW) of leaf tissues.

Visualization of plant tissue necrosis and cell death

To observe plant necrosis, the bacteria-inoculated leaves were cleared in 95% ethanol overnight to remove chlorophylls. The ethanol-cleared leaves were taken photographed.
To visualize death under a microscope, bacteria-inoculated leaves were detached and leaf fragments (5 × 5 mm2) were prepared far from the syringe-infiltrated sites to avoid errors by the mechanical wounding. Leaf chlorophylls were removed by boiling the leaf fragments in 95% ethanol for 10 min. The leaf fragments were transferred to lactophenol (phenol 20 ml, lactic acid 20 ml, glycerol 40 ml and distilled water 20 ml) and boiled for 10 min to remove completely the chlorophylls. Dead plant leaf cells were stained with trypan blue (0.00625%) prepared in the lactophenol, and excess blue stains were destained in lactophenol by boiling for 5 min. The trypan blue-stained leaf cells were observed under a light microscope and photographed.

RNA isolation and quantitative RT-PCR analyses

Total RNA was isolated from the leaves using RiboEx solution (GeneAll, Seoul, Korea) (Lee et al., 2022b). Total RNAs prepared in DEPC-treated water were treated with RNase-free DNase (Promega, Madison, WI, USA) to eliminate any contaminated genomic DNA according to the manufacturer’s protocol. cDNAs were synthesized from the total RNA using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR analysis was performed using a Bio-Rad CFX96 thermal cycler (Bio-Rad, Hercules, CA, USA) with EvaGreen fluorescent dye (Biotium, Inc., Fremont, CA, USA). Linear data were normalized to the mean threshold cycle of Brassica rapa actin 7 gene (BrAct7). Gene-specific PCR primer pairs are listed in Table 1.

Statistical analyses

An analysis of variance (ANOVA) was conducted to determine the effects of various treatments on plant responses such as trypan blue-stained cell numbers, electrolyte leakages, lipid peroxidation, gene expression, as well as in planta bacterial growth. The data are statistically analyzed using the SAS version 9.1 (Statistical Analysis System, Cary, NC, USA). Means were compared using the least significant difference tests. Graphs were drawn using SigmaPlot 10.0 (Systat Software, Inc., San Jose, CA, USA).

Results

Different plant cell death and in planta bacterial growth in the Xcc- and Xcv-inoculated Chinese cabbage leaves

Inoculating adapted and non-adapted strains of X. campestris led to different cell death responses in the Chinese cabbage leaves (Fig. 1). The Xcc- and Xcv-inoculated leaves were observed at 0 (immediately after the bacterial inoculation) and 24 h (Fig. 1A). Xcc did not cause any visual tissue collapse in the inoculated leaves, but Xcv triggered rapid tissue damage at the inoculated site at 24 h. The different responses of the inoculated leaves were clearly shown by removing chlorophylls in ethanol. In particular, brown tissue discoloration was only found in the Xcv-inoculated leaf areas at 24 h but not in mock- and Xcc-inoculated ones.
To investigate bacterial proliferation within the inoculated leaf tissues in situ during the different cell death responses caused by adapted and non-adapted strains of X. campestris, high doses (107 cfu/ml) of the bacterial suspensions were inoculated and living bacterial cell numbers were counted at 0, 6 and 24 h (Fig. 1B). Xcc growth decreased temporarily at 6 h (0.96 log-fold) compared to 0 h but increased at 24 h (1.09 log-fold) compared to the growth at 0 h. In contrast, bacterial growth for the Xcv was found differently at the same time points. Xcv growth increased at 6 h compared to 0 h (1.05 log-fold) but returned to the initial level of bacterial number at 24 h. Xcv grew slightly more than Xcc at 6 h (1.11 log-fold). But Xcc growth was significantly higher (1.10 log-fold) than Xcv at 24 h, at which the hypersensitive response was found in the leaves inoculated by Xcv.
Plant cell death occurrence was also predominantly observed in the leaves inoculated by the non-adapted bacteria under a light microscope (Fig. 1C). Under observation at 100× magnification, no distinct trypan blue staining was found in the mock-inoculated leaves and only scattered blue stains were observed in the Xcc-inoculated leaves at 24 h. But non-adapted Xcv inoculation led to prominent trypan blue stains widespread in the inoculated leaves at 24 h. The number of trypan blue-stained cells in the inoculated leaves was measured (Fig. 1D). Xcc inoculation increased the number of trypan blue-stained cells compared to mock inoculation, and Xcv inoculation led to a higher number of cells stained by trypan blue. The inoculated leaf tissues were observed under observation at 400× magnification (Fig. 1E). Most mesophyll cells showed typical round shapes in the mock-inoculated leaves. A few collapsed and stained cells were observed in the Xcc-inoculated leaves, and most cells without distinct trypan blue staining looked normal in cellular shape. Many mesophyll cells were collapsed and stained in the Xcv Bv5-4a.1-inoculated leaves, and most cells without deep staining also showed degenerated forms.

HCD-associated electrolyte leakage and lipid peroxidation in Chinese cabbage leaves by non-adapted Xcv

Electrolyte leakage and lipid peroxidation were differently found in the Chinese cabbage leaves during different cell death responses to adapted Xcc and non-adapted Xcv strains, and cellular changes were more prominent in the leaves inoculated by the non-adapted Xcv Bv5-4a.1 (Fig. 2).
Electrolyte leakages from the inoculated leaves to investigate changes in membrane stability (Fig. 2A). Electrolyte leakages did not occur in the leaves inoculated by Xcc or Xcv at 1 h compared to the mock-inoculated leaves, and a slight reduction was detected in the mock-inoculated leaves at 6 h. Electrolyte leakages from the mock-inoculated leaves at 24 h, returned to the level at 1 h. Increased electrolyte leakages were found in the Xcc-inoculated leaves at 24 h compared to those from mock-inoculated leaves, and Xcv inoculation drastically increased electrolyte leakages compared to those from mock- and Xcc-inoculated leaves.
Lipid peroxidation as a biochemical marker for oxidative stress was compared in the inoculated leaves by measuring amounts of TBARS (Fig. 2B). Lipid peroxidation did not occur in the leaves by Xcc or Xcv until 6 h compared to the mock-inoculated leaves. At 24 h, Xcc inoculation slightly increased lipid peroxidation at 24 h compared to the mock inoculation, and Xcv markedly elevated lipid peroxidation to a significantly higher level compared to the Xcc inoculation.

Different transcriptional regulation of defense-related genes in Chinese cabbage leaves by adapted Xcc and non-adapted Xcv

Expression of six Chinese cabbage defense-related genes, BrPR1, BrPR4, BrChi1, BrGST1, BrAPX1 and BrVSP2, was analyzed in the leaves at 24 h after mock, Xcc and Xcc inoculation (Fig. 3). Five genes BrPR1, BrPR4, BrChi1, BrGST1 and BrAPX1 showed similar expression patterns. Moderate inductions by Xcc and drastic increases by Xcv were commonly found compared to mock inoculation. By contrast, BrVSP2 gene expression was significantly reduced by Xcc compared to mock inoculation, and much less gene expression was followed by Xcv.

Day length-regulated HCD and bacterial growth in the leaves inoculated by non-adapted Xcv

The effect of light length on the Xcv-triggered HCD and non-adapted bacterial growth in the Chinese cabbage leaves was evaluated (Fig. 4). Prolonged light and dark environments differently changed the HCD in the Xcv-inoculated leaves compared to the standard light length (12-h day/12-h night) (Fig. 4A). Continuous light did not alter the electrolyte leakages in the mock-inoculated leaves at 8 h, but continuous darkness slightly increased the electrolyte leakages compared to the standard light length. The distinct increases in the electrolyte leakages in the Xcv-inoculated leaves under the standard light length compared to mock-inoculation were detected at 8 h. However, the Xcv-mediated elevated electrolyte leakages were not changed by continuous light and dark conditions at 8 h. At 24 h, continuous light slightly attenuated the electrolyte leakages from the mock-inoculated leaves, but constant darkness increased the electrolyte leakages compared to the standard light length. Remarkable increases in the electrolyte leakages appeared in the Xcv-inoculated leaves under the standard light length at 24 h compared to 8 h. The continuous light decreased the electrolyte leakages from the Xcv-inoculated leaves compared to the standard light length, but continuous dark elevated the electrolyte leakages. Altered light length also changed the in planta bacterial growth of Xcv in the Chinese cabbage leaves (Fig. 4B). Bacterial growth of Xcv was reduced in the leaves at 24 h after inoculation compared to 0 h under the standard light length. The continuous light environment could not change the in planta Xcv bacterial population compared to the standard light length. In contrast, the Xcv bacterial growth was notably accelerated under constant dark conditions.

RH-regulated HCD and bacterial growth in the leaves inoculated by non-adapted Xcv

The effect of RH on the Xcv-triggered HCD and non-adapted bacterial growth in the Chinese cabbage leaves was evaluated (Fig. 5). The HCD occurrence and tissue browning at the Xcv-inoculated areas were distinctly attenuated by prolonged high RH (Fig. 5A). Under moderate RH conditions, visible leaf damage (red arrows) was found only in the Xcv-inoculated leaves at 24 hpi, and brown discoloration (green arrows) in the leaves with the tissue collapse was evident after the ethanol clearing. The visible leaf damage (red arrows) and brown discoloration (green arrows) in the Xcv-inoculated leaves were also observed at 24 hpi under high RH conditions for 8 h. Water-soaked symptoms (white arrows) were found in the mock- and Xcv-inoculated leaves at 8 hpi under high RH conditions for 8 h. No visible leaf damage and brown discoloration were observed in the mock- and Xcv-inoculated leaves at 24 hpi under high RH conditions for 24 h, and only water-soaked symptoms (white arrows) were found. The occurrence of HCD in the Xcv-inoculated leaves was delayed by the continued high RH, which was shown by decreased electrolyte leakages from the inoculated leaves (Fig. 5B). Under a high RH for 8 h, changes in electrolyte leakages were not detected in the mock-inoculated leaves at 8 h compared to the moderate RH condition. Without the high RH, electrolyte leakages were slightly increased in the mock-inoculated leaves at 24 h compared to 8 h. The high RH for 8 h did not affect the electrolyte leakages in the mock-inoculated leaves at 24 h. However, continuous high RH for 24 h slightly reduced electrolyte leakages in the mock-inoculated leaves. Xcv inoculation increased the electrolyte leakages at 8 h without a high RH. However, the high RH for 8 h suppressed the Xcv-triggered electrolyte leakages. The electrolyte leakages were significantly elevated in the Xcv-inoculated leaves at 24 h without a high RH compared to 8 h. The high RH for 8 h could not alter the Xcv-triggered electrolyte leakages compared to the usual RH condition, whereas continuous high RH for 24 h considerably decreased the electrolyte leakages. The increasing high RH period compromised the bacterial growth of non-adapted Xcv limited in the Chinese cabbage leaves (Fig. 5C). In the absence of high RH, the Xcv bacterial population was maintained in the leaves at 24 h. By contrast, the high RH for 8 h moderately raised the Xcv bacterial growth compared to the moderate RH condition. The Xcv bacterial number was significantly augmented in the leaves under continuous high RH for 24 h compared to the 8 h high RH.

Effect of fluridone and ABA pretreatment on the HCD and bacterial growth in the leaves inoculated by a non-adapted Xcv

ABA is known to be involved in the light and RH responses of plants. To investigate the involvement of ABA in the establishment of HCD and non-adapted Xcv bacterial growth in the leaves, fluridone (ABA inhibitor) and ABA were exogenously applied to the seedlings at 1 day before Xcv inoculation. The electrolyte leakages from the Xcv-inoculated leaves treated with mock, fluridone and ABA were measured at 8 and 24 h and the bacterial proliferation was evaluated at 24 h (Fig. 6).
Fluridone pretreatment increased the Xcv-triggered electrolyte leakages in the leaves, but ABA pretreatment alleviated the electrolyte leakages at 8 and 24 h (Fig. 6A). At least 10 μM of fluridone increased the electrolyte leakages from the Xcv-inoculated leaves compared to the mock (0 μM) at 8 h. Although increasing fluridone concentrations to 20-100 μM, the elevated level of electrolyte leakages by 10 μM of fluridone was maintained. Fluridone pretreatment with 5 to 20 μM did not change the electrolyte leakages compared to the mock (0 μM), but higher fluridone doses (50 and 100 μM) augmented the electrolyte leakages from the Xcv-inoculated leaves at 24 h. Pretreatment with ABA (10 to 100 μM) gradually reduced the electrolyte leakages in a dose-dependent manner at 8 h. Only the highest ABA concentration (100 μM) could attenuate the electrolyte leakages slightly compared to the mock (0 μM) at 24 h.
Non-adapted Xcv bacterial growth in the leaves was not altered by fluridone pretreatment but reduced by ABA pretreatment (Fig. 6B). At 24 h, Xcv bacterial growth was not changed in the leaves pretreated with two doses (10 and 100 μM) of fluridone compared to the mock treatment (0 μM). The Xcv bacterial population in the leaves pretreated with 10 μM of ABA was not changed, and the higher ABA to 100 μM slightly reduced Xcv growth (0.92 log-fold) in the leaves at 24 h.

Discussion

Chinese cabbage plants, an economically important vegetable, have suffered from different diseases, including black rot caused by the bacteria Xanthomonas campestris pv. campestris (Xcc). Xanthomonas campestris pv. vesicatoria (Xcv) causes bacterial spots in susceptible cultivars of tomato and pepper plants but triggers HCD in non-host plants to enhance plant immunity. A high Xcv titer (more than 107 cfu/ml) induced HCD in the non-host bean leaves (Whalen et al., 1988). A high titer (4 × 108 cfu/ml) of Xcv infiltrated into the non-host Nicotiana benthamiana leaves led to HCD, but the Xcv mutant deficient in effector protein XopX could not induce the HCD (Metz et al., 2005). Non-host N. tabacum leaves also showed HCD by infiltrating a high Xcv titer (108 cfu/ml), and the generation of reactive oxygen species was suggested as an HCD-inducing factor in response to the non-adapted Xcv (Zurbriggen et al., 2009). More than 106 cfu/ml of Xcv elevated electrolyte leakage at the non-host Citrus sinensis leaves, indicating HCD occurrence (Daurelio et al., 2013). In our previous study, two strains 85-10 and Bv5-4a.1 of Xcv were inoculated in the Chinese cabbage leaves by two different inoculation methods, and Xcv-triggered plant responses were compared with Xcc-inoculated leaves under disease development (Lee and Hong, 2012). A virulent Xcc strain 8004 mediated progressive chlorotic symptoms at the inoculated Chinese cabbage leaves by leaf clipping method, whereas none of the visual change was found in the leaves clipping inoculated with the two Xcv strains. It seems that the non-adapted Xcv bacterial invasion was halted at the main vein of the Chinese cabbage leaves by the early activated defense. By contrast, syringe-infiltrating a high Xcv titer into the leaves resulted in the occurrence of HCD, but no apparent change was observed in the Xcc-inoculated leaves at the same time point. In the current study, high titers of Xcc and Xcv were infiltrated into the Chinese cabbage leaves to investigate different plant responses against the adapted and the non-adapted bacteria via the direct contact of the bacterial cells with non-host plant cells. Xcv-triggered HCD was observed within 24 h, as we found in our previous study. Generally, a low titer of non-adapted bacteria, such as 104 and 105 cfu/ml, was infiltrated into leaves of various non-host plants to evaluate whether growth of non-adapted bacterial species are indeed suppressed in the inoculated leaves so far, and it successfully has shown the limited or delayed growth of the non-adapted bacteria (Gupta et al., 2013; Lee et al., 2022a; Whalen et al., 1988). However, it is difficult to find that HCD was observed macroscopically in the non-host plant leaves inoculated by the low titer of the non-adapted bacteria. In our previous study, in planta bacterial growth of Xcc and Xcv were compared in the leaves by infiltrating bacterial suspensions (105 cfu/ml), and a distinct difference between Xcc proliferation and Xcv suppression was shown over time. No distinct HCD was found in the Chinese cabbage leaves inoculated by Xcv by 14 dpi. In the current study, a high titer (107 cfu/ml) of the bacterial suspensions was applied to evaluate bacterial growth of Xcv in the HCD-appearing leaves, and compared with the adapted Xcc bacterial growth in the inoculated leaves. A slight reduction of Xcc growth at 6 h may be due to activated basal immunity at the early hour. The slight and temporary suppression of Xcc strain 8004 growth was also found in the susceptible Arabidopsis ecotype Col-0 at early inoculation time (Lummerzheim et al., 1993). Several pattern-triggered immunity, mediated by the pattern and corresponding receptor interactions, were revealed in Arabidopsis, and the receptor homologs against Xcc were suggested in the Chinese cabbage genome (Kim et al., 2020). The basal plant immunity transiently activated by phytopathogenic bacteria, including Xcc, needs further elucidation in Chinese cabbage plants. Xcc could overcome the basal immunity at 24 h, showing increased growth, followed by progressive symptom appearance a few days later. Surprisingly, Xcv growth increased in the leaves transiently at 6 h when HCD did not occur, although the Xcv growth declined soon with HCD occurrence in the inoculated leaves at 24 h. Non-adapted bacteria Xanthomonas oryzae pv. oryzae (Xoo) in the C. sinensis leaves drastically decreased after inoculation (Rani and Podile, 2014). However, Chinese cabbage leaves are likely to allow a proliferation of the non-adapted Xcv temporarily; they have time to prepare and trigger HCD to suppress the bacterial growth of Xcv actively. It is similar to the slightly increased and maintained growth of a non-adapted bacteria Xcc within the non-host leaves of the C. limon (Chiesa et al., 2019).
Many mesophyll cells were dying by Xcv at 24 h, and it was comparatively higher than dying cell numbers in the Xcc-inoculated leaves. Notably, HCD with tissue collapse was found in the Xcv-inoculated leaves, but not all mesophyll cells were stained. Only massively collapsed cells stained in the Xcv-inoculated leaves were observed, but many degenerating cells were not stained. The non-adapted Xcv may still be alive in the degenerating cells as evidenced by the steady status of Xcv bacterial growth level at 24 h. It may need further evaluation of the Xcv bacterial growth after 24 h to see distinct and complete suppression of the non-adapted Xcv in the Chinese cabbage leaves established with HCD.
Increased electrolyte leakage and lipid peroxidation have been physiological hallmarks of plant HCD in response to invasion of avirulent or non-adapted pathogen strains. Rapidly increased electrolyte leakage indicating loss of cell membrane integrity was seen during the non-adapted pathogen-related HCD establishment (Chiesa et al., 2019; Gupta et al., 2013; Krzymowska et al., 2007). Lipid peroxidation associated with the HCD has been described with or without increased electrolyte leakage. The augmented electrolyte leakage and lipid peroxidation were concomitantly found in the cucumber cotyledons by a non-adapted Pseudomonas syringae pv. pisi, but these reactions were not prominent by a virulent strain of P. syringae pv. lachrymans (Keppler and Novacky, 1986). HCD appeared in the Citrus sinensis leaves in response to a non-adapted bacteria Xoo and significant increase in lipid peroxidation was found in the Xoo-inoculated C. sinensis leaves at the early hours after the bacterial inoculation (Rani and Podile, 2014; Rani et al., 2015). But lipid peroxidation by an adapted X. axonopodis pv. citri (Xac) was only slightly increased at the later infection stage (Rani et al., 2015). Highly increased lipid peroxidation in the Xcv-inoculated Chinese cabbbage leaves suggests involvement of oxidative burst in the HCD-associated events. Increased production of H2O2 was detected in the Arabidopsis leaves inoculated by non-adapted bacteria P. syringae pv. tabaci and P. syringae pv. glycinea, but no H2O2 production was compared in the leaves inoculated by a virulent adapted strain of P. syringae (Ishiga et al., 2016). A preferential H2O2 increase was found in the Xoo-inoculated C. sinensis leaves, in line with lipid peroxidation during the non-host plant immunity (Rani et al., 2015). Two antioxidant enzymes, peroxidase and superoxide dismutase, were highly activated in the non-adapted Xoo-inoculated C. sinensis leaves compared to those in the adapted Xac-inoculated leaves (Rani et al., 2015). Significantly up-regulated BrGST1 and BrAPX1 gene expression in the Xcv-inoculated leaves shows indirect evidence of the relatedness of antioxidant responses in the non-host plant immunity of Chinese cabbage. Mung bean Cu/Zn-SOD and APX genes were drastically up-regulated in the leaves by non-adapted X. hortorum pv. pelargoni as compared to those by adapted X. axonopodis pv. phaseoli, suggesting the roles of activated antioxidant responses in the non-host plant immunity (Farahani and Taghavi, 2016). Investigation of the accumulation of reactive oxygen species and antioxidant responses in the Xcv-inoculated leaves will provide insight into the biochemical immunity of Chinese cabbage plants.
Drastically increased expression of defense-related genes BrPR1, BrPR4 and BrChi1, was also one of the molecular strategies in Chinese cabbage leaves against the non-adapted Xcv. PR1 was also highly up-regulated in the C. limon leaves inoculated with a non-adapted X. campestris pv. campestris, but a virulent adapted strain of X. citri induced relatively low PR1 gene expression (Chiesa et al., 2019). PR1a, PR1b and PR2b genes in tomato leaves were highly expressed in response to a non-adapted P. syringae pv. tabaci inoculation, but their induction by a virulent adapted strain Pst was relatively weak (Lee et al., 2013). These differentially up-regulated PR genes were known to encode antimicrobial peptides trafficking to different cellular compartments (Ali et al., 2018; Han et al., 2023; Kim and Hwang, 2015; Pečenková et al., 2022). PR proteins can form complexes with other PR protein or non-PR protein members to enhance plant immune responses (Hwang et al., 2014; Ma et al., 2018; Wang et al., 2020). These findings suggest that simultaneously up-regulated distinct PR gene expressions might have cooperated with each other to efficiently halt invading non-adapted pathogens via antimicrobial activities and/or plant cell death regulation. PR1a and PR4 genes increased strongly in Chinese cabbage leaves inoculated with a non-adapted Pst, and PR1a, PR1b, PR5a and PR5b gene expressions were induced in tobacco leaves by a non-adapted Psm (Krzymowska et al., 2007; Park et al., 2005). However, these PR gene expression during the non-host plant immunity was not compared to expressions in the Chinese cabbage and tobacco leaves during the susceptible responses. Preferential transcriptional activation of these PR genes in the present study might efficiently establish non-host plant immunity against the non-adapted Xcv in Chinese cabbage leaves. Several genes encoding functionally unknown proteins were identified in the Pst-inoculated Chinese cabbage leaves during the HCD-mediated non-host immunity (Park et al., 2005). Novel genes involved in non-host immunity were discovered from Xac-inoculated tobacco and Xcv-inoculated C. sinensis leaves (Daurelio et al., 2011, 2013). Transcriptome analysis of Chinese cabbage genes regulated explicitly by the Xcv-triggered HCD will provide a clue on the molecular basis of non-host immunity of Chinese cabbage plants against the non-adapted bacterial species. In contrast to the other PR genes, drastically reduced BrVSP2 expression in the Xcc- and Xcv-inoculated Chinese cabbage leaves may suggest suppressed jasmonic acid signaling and/or activated salicylic acid signaling during the basal and non-host plant immunity (Cao et al., 2016; Leon-Reyes et al., 2010). Notably, Arabidopsis AtVSP2 and Chinese cabbage BrVSP2 were inducible genes by attacks from various insect herbivores with chewing and piercing/sucking behavior (Abe et al., 2008, 2009; Cao et al., 2016; Verhage et al., 2011). Investigating the responses of Chinese cabbage plants to the invasion by various pathogens or insects into the Xcc- or Xcv-inoculated leaves will provide insight into multiple plant interactions with microbes and insects in Chinese cabbage fields as suggested in a variety of plant-pathogen-insect interaction systems (Desurmont et al., 2016; Franco et al., 2017; Ontiveros et al., 2022; Sun et al., 2016).
Xcv-secreted effectors and Chinese cabbage interacting partners that trigger the HCD accompanying lipid peroxidation and PR gene activation have still not been uncovered. The effectors XopB, XopJ and XopS delivered by Xcv attenuated immunity in the susceptible pepper plant to facilitate bacterial invasion and in planta proliferation (Kay and Bonas, 2009; Priller et al., 2016; Raffeiner et al., 2022; Schulze et al., 2012; Üstün et al., 2013). Searching for Xcv effectors triggering HCD and non-host immunity in Chinese cabbage plants should be investigated, as demonstrated in recognizing Xcv effectors avrRxv and XopQ by non-host plants (Adlung et al., 2016; Whalen et al., 1988).
Environmental conditions have influenced plant immunity against pathogen attacks. In particular, changes in light conditions, such as different light intensities and periods, altered disease susceptibility and resistance of host plants. Low light intensity increased tomato bacterial specks showing more severe lesions and in planta bacterial growth compared to standard light (Luo et al., 2023). Continuous light ameliorated bacterial specks in Arabidopsis leaves inoculated by a virulent Pst strain, whereas continuous dark accelerated symptom development compared to the usual light regime (Lajeunesse et al., 2023). By contrast, in planta Pst bacterial population in Arabidopsis leaves was reduced by the continuous light, but was not affected by constant dark (Lajeunesse et al., 2023). Continuous dark increased bacterial growth of X. campestris pv. malvacearum (Xcm) in the resistant cotton cultivar compared to the usual light/dark regime, but the continuous dark did not change highly proliferated bacteria in the susceptible cultivar (Morgham et al., 1988). However, there was no information on whether the compromised Xcm bacterial growth in the resistant cultivar under continuous dark is associated with altered HCD. Immediate bacterial inoculation after illumination initiation led to higher salicylic acid accumulation and earlier PR-1 gene expression in Arabidopsis inoculated with an avirulent Psm than the inoculation at later times, which was closely associated with HCD occurrence and the suppressed in planta bacterial growth under a prolonged light period (Griebel and Zeier, 2008). Transiently expressed Zymoseptoria tritici effector protein candidates in non-host N. benthamiana leaves triggered HCD under 16 h-day light condition, but continuous dark suppressed the HCD (Kettles et al., 2017). These indicated that a limited light period and intensity might provide favorable environments to virulent bacteria during the pathogenesis, but prolonged light periods and high light intensity seem to contribute to plant immunity to an avirulent strain triggering HCD in their hosts. HCD associated with plant immunity was also regulated by light conditions. Nevertheless, the involvement of ambient light conditions in the HCD-mediated NHR is rarely described so far. Unexpectedly, the light period is likely to negatively regulate HCD in Chinese cabbage leaves against Xcv, in the present study. Reduced HCD under the prolonged light period and accelerated HCD under complete darkness were found in the Xcv-inoculated Chinese cabbage leaves. It was contrary to the long day-dependent HCD in the resistant host plants against avirulent strains. Notably, continuous light and dark also reduced and increased the electrolyte leakages from the mock-inoculated leaves at 24 h, respectively, indicating that the light period alone can regulate plant membrane permeability regardless of the non-adapted Xcv inoculation in the Chinese cabbage leaves. It remains how light modulates the membrane permeability of Chinese cabbage leaves with or without Xcv inoculation. In planta bacterial population of the non-adapted Xcv drastically increased in the Chinese cabbage leaves under continuous dark, although continuous light could not affect the Xcv bacterial proliferation. Illumination for 12 h was sufficient to establish NHR in Chinese cabbage leaves against non-adapted Xcv. We did not determine the minimum dark period for the compromised Xcv bacterial growth suppression. Still, a critical continuous dark period necessary to lower NHR will be more than 12 h. In recent decades, increasing evidence has suggested a connection between the light environment and plant immunity associated with molecular recognition and signaling (Ahammed et al., 2018; Gao et al., 2020; Iqbal et al., 2021). Unidentified key determinants involved in the NHR against Xcv might be down-regulated or degraded under more extended dark periods of more than 12 h, and searching these molecules will provide more insights into the deployment of NHR.
High RH has profoundly enhanced plant disease susceptibility. Rice blast, tomato grey mould and Arabidopsis bacterial speck on leaves developed progressively under the higher RH (Li et al., 2023; Qiu et al., 2022; Yao et al., 2023). Prolonged leaf wetness provided favorable environments for Asiatic citrus canker by X. smithii ssp. citri and peach-almond hybrid bacterial spot by X. arboricola pv. pruni (Dalla Pria et al., 2006; Morales et al., 2018). RH-modulated HCD triggered in plants by avirulent adapted strains was rarely described. Intercellular washing fluids from the susceptible tomato leaves inoculated by Cladosporium fulvum race 0 caused grey necrosis in the Cf-9 gene-harbouring tomato leaves under 70% RH, whilst only slight chlorosis was developed on the leaves of the same tomato genotype under 98% RH, suggesting Cf-9/Avr9 interaction-dependent HCD delayed and reduced by high RH (Hammond-Kosack et al., 1996). Tomato seedlings simultaneously overexpressing tomato Cf-9 gene and C. fulvum Avr9 gene displayed necrotic spots on the cotyledons at 2-3 days after emergence under 70% RH, but increased RH to 95% delayed the HR to 14-16 days after emergence (Wang et al., 2005). Arabidopsis lesion mimic mutant cpn1-1 accelerated HCD against an avirulent Psm carrying avrRpt2 compared to wild-type, but the accelerated HCD in the cpn1-1 was compromised under high RH (Jambunathan et al., 2001). Another Arabidopsis lesion mimic mutant ssi4 also showed spontaneous cell death in the absence of pathogen attack under moderate RH, but the cell death did not appear under high RH (Zhou et al., 2004). RH-dependent HCD regulation against invading non-adapted pathogens has not been described in the plants so far. In the present study, increased wetness negatively influenced the HCD as well as plant immunity in Chinese cabbage leaves against the non-adapted Xcv. It matched previous findings with high RH-mitigated HCD and/or plant immunity in plants. The high RH may suppress the activation of NHR-associated responses, such as defense-related gene expression and defense signaling molecule level (Jambunathan et al., 2001; Qiu et al., 2022; Zhou et al., 2004). It will be worth investigating whether lipid peroxidation and defense-related gene expression highly up-regulated during the Xcv-triggered HCD in the Chinese cabbage leaves were also dependent on light and RH conditions.
During the HCD establishment by the non-adapted Xcv, ABA production and stomatal closure may be differently regulated under different light/dark regimes in the Chinese cabbage leaves. ABA levels were elevated by extended darkness in several plants (Weatherwax et al., 1996; Yang et al., 2000). The continuous dark can accelerate stomatal closure by activating ABA signaling, which leads to lessening water loss caused by the HCD occurrence in the leaves. Surprisingly, the continuous dark for 24 h accelerated HCD in the Xcv-inoculated leaves. Highly proliferated Xcv within the Chinese cabbage leaf tissues under constant dark conditions can derive accelerated HCD.
High RH has activated oxidative catabolism of ABA via 8′-hydroxylase genes and reduced ABA levels in Arabidopsis leaves (Arve et al., 2015; Okamoto et al., 2009). Lowered ABA by ambient high RH perturbed usual plant behavior, including the stomatal response in guard cells (Okamoto et al., 2009). High RH-suppressed pre-invasive plant immunity was correlated with compromised ABA-mediated stomatal closure in response to bacterial invasion from the leaf surface. Still, the high RH could not change the apoplastic population of the bacteria inoculated by leaf infiltration (Panchal et al., 2016). In the present study, the non-adapted Xcv was syringe-infiltrated into the leaves for direct contact of Xcv with plant mesophyll cells, and it could lead to HCD and suppressed bacterial growth. To investigate the association of ABA with high RH-suppressed HCD and plant immunity against Xcv in the Chinese cabbage leaves, ABA and fluridone were exogenously applied before Xcv inoculation under moderate RH conditions. It demonstrates that ABA attenuates HCD in the Chinese cabbage leaf cells encountered with the non-adapted Xcv. The endogenous and pretreated ABA may play in the guard cells and contribute to stomatal closure, and make keep the internal moisture of the Xcv-inoculated leaves intact and protect the leaves from HCD accompanied by tissue collapse. It was the opposite effect of high RH on the Xcv-triggered HCD. Although the high RH inhibits ABA accumulation in the leaves and makes stomata open, the high RH alone around the Xcv-inoculated leaves could preserve the leaves from water loss due to HCD occurrence and delay the HCD. However, ABA may induce stomatal closure to minimize water loss caused by the HCD under moderate RH conditions. Three ABA 8′-hydroxylase genes differently regulated by heat stress were found in two Chinese cabbage lines (Dong et al., 2015). More insights on the altered Xcv-triggered HCD by high RH and ABA can be provided by studies on the regulation of the Chinese cabbage ABA 8′-hydroxylase under different RH regimes and changed endogenous ABA levels. More recently, it has been found that Pst-secreted effector AvrPtoB targets ABA 8′-hydroxylase to promote the bacterial virulence in Arabidopsis (Liu et al., 2022). Investigating Xcv effectors regulating Chinese cabbage HCD and plant immunity through ABA signaling pathways will also pave the way to decipher the role of Xcv bacterial effectors in NHR differently regulated by environmental conditions.
ABA has negatively affected basal plant immunity against bacterial infection in plant mesophyll cells by inhibiting salicylic acid defense signaling as a post-invasive defense (Cao et al., 2011). Generally, the disease susceptibility of host plants against Xanthomonas spp. was enhanced by ABA. Citrus canker development by X. citri subsp. citri was promoted in the ABA-treated orange leaves, concomitant with increased jasmonic acid and decreased salicylic acid (Long et al., 2019). Exogenous ABA increased lesion length of rice leaf blight by Xoo, whereas reduced endogenous ABA by fluridone induced disease resistance (Xu et al., 2013). By contrast, neither ABA nor fluridone changed the rice leaf blight severity in resistant rice plants (Xu et al., 2013). It has rarely been described that ABA acts as a positive regulator of plant immunity against pathogens, including non-adapted pathogens, except for the role in stomatal closure. ABA-induced resistance was found in tomato plants to Alternaria solani and Arabidopsis to Meloidogyne paranaensis (de Souza Yop et al., 2023; Song et al., 2011). In this study, exogenous ABA enhanced plant immunity against the non-adapted Xcv in mesophyll cells of Chinese cabbage leaves, showing the reduced Xcv population. Xcv-triggered HCD attenuated by exogenous ABA indicates that ABA plays different roles in HCD occurrence and in planta bacterial suppression in Chinese cabbage leaves against the non-adapted Xcv. The increased Xcv bacterial growth in the leaves under the prolonged high RH may derive from reduced ABA levels in the mesophyll cells. Increased activities of phenylalanine ammonia-lyase, peroxidase and polyphenol oxidase were suggested as tomato defence responses during the ABA-induced resistance to the early blight (Song et al., 2011). G-protein α-subunit is required for the ABA-induced resistance in rice plants against brown spots (de Vleesschauwer et al., 2010). How exogenous ABA could enhance non-host plant immunity in the Chinese cabbage mesophyll cells remains elucidated.
In conclusion, Chinese cabbage seedlings responded differently to the adapted and non-adapted pathovars of Xanthomonas campestris, showing different physiological and molecular features (Fig. 7). No drastic change in plant cell death, oxidative stress and defence gene expression were demonstrated in the adapted Xcc-inoculated leaves, but the in planta bacterial growth was allowed without visible symptoms at 24 h. By contrast, plant immunity against the non-adapted Xcv distinctly occurred, accompanied by HCD, lipid peroxidation, and highly activated defense gene expressions in the leaves. The HCD occurrence and suppressed non-adapted bacterial proliferation in the leaves were modulated by environmental conditions such as light length and RH and by endogenous colonization of the adapted Xanthomonas species. ABA is likely to be involved in the HCD and non-adapted Xcv bacterial growth in Chinese cabbage leaves. Further investigation on different physiological, metabolic and transcriptional changes of Chinese cabbage leaves in response to the adapted Xcc and non-adapted Xcv will provide a better understanding of the onset of HCD and defense signaling in NHR.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This work was financially supported by National Research Foundation (NRF) of Korea, Ministry of Education, Science and Technology (MEST) of Korea government (grant no. NRF-2020R1A2C1101613), Republic of Korea.

Fig. 1
Non-adapted bacteria-triggered hypersensitive cell death in Chinese cabbage leaves. (A) Differential tissue damage in the leaves inoculated by bacterial suspensions (107 cfu/ml) of the adapted and non-adapted strains of Xanthomonas campestris pathovars. A virulent adapted strain 8004 of X. campestris pv. campestris (Xcc) and a non-adapted strain Bv5-4a.1 of X. campestris pv. vesicatoria (Xcv) were syringe-infiltrated into the abaxial surface of the primary leaves of Chinese cabbage seedlings. Localized tissue collapse in the Xcv-inoculated leaves were visualized with or without removing chlorophylls by ethanol. Photos were taken at 0 (immediately after the bacterial inoculation) and 24 h. (B) Bacterial growth of Xcc and Xcv in the inoculated leaves. Xcc and Xcv bacterial suspensions (107 cfu/ml) were syringe-infiltrated, and bacterial numbers were counted at 0, 6, and 24 h. The data are the means ± standard errors of the five independent experimental replicates. Each experiment contained four biological replicates. Means with the same letter above the bars are not significantly different at the 5% level by the least significant difference tests. (C) Microscopic observations of different cell death occurrences in the leaf tissues inoculated by Xcc and Xcv at 24 h. Dying leaf cells stained by trypan blue in the leaf tissues were observed under a light microscope. Scale bars = 100 μm. (D) Trypan blue-stained cells in the inoculated leaves seen in the photos were counted and quantified as numbers/mm2. The data are the means ± standard errors of the five independent experimental replicates. Four to 12 photos for each treatment were used for an independent experiment. Means with the same letter above the bars are not significantly different at the 5% level by the least significant difference tests. (E) Mesophyll cells of the Xcc and Xcv-inoculated leaves at 24 h. Arrows indicate collapsed leaf cells. Scale bars = 25 μm.
ppj-oa-03-2024-0057f1.jpg
Fig. 2
Preferentially elevated oxidative stress in the Chinese cabbage leaves during the non-adapted bacteria-triggered hypersensitive cell death. (A) Relative electrolyte leakages (%) and (B) lipid peroxidation in the leaves inoculated with an adapted strain X. campestris pv. campestris (Xcc) 8004, and a non-adapted strain X. campestris pv. vesicatoria (Xcv) Bv5-4a.1. Chinese cabbage leaves were syringe-infiltrated with bacterial suspension (107 cfu/ml) of Xcc and Xcv and harvested at 1, 6 and 24 h. Sterile water was infiltrated as a mock inoculation. TBARS, thiobarbituric acid reactive substances. The data are the means ± standard errors of the four independent experimental replicates. Each experiment has four replications. Means with the same letter above the bars are not significantly different at the 5% level by the least significant difference tests.
ppj-oa-03-2024-0057f2.jpg
Fig. 3
Expression of defense-related genes in the Chinese cabbage leaves inoculated by the adapted and non-adapted strains of Xanthomonas campestris pathovars. A virulent adapted strain 8004 of X. campestris pv. campestris (Xcc) and a non-adapted strain Bv5-4a.1 of X. campestris pv. vesicatoria (Xcv) were syringe-infiltrated into the abaxial surface of the primary leaves of Chinese cabbage seedlings. Gene expressions were analyzed using leaf tissues harvested at 24 h. BrPR1, Brassica rapa pathogenesis-related protein 1 gene; BrPR4, Brassica rapa pathogenesis-related protein 4 gene; BrChi1, Brassica rapa chitinase 1 gene; BrGST1, Brassica rapa glutathione S-transferase 1 gene; BrAPX, Brassica rapa ascorbate peroxidase gene; BrVSP2; Brassica rapa vegetative storage protein 2 gene. The data are the means ± standard deviations of the three independent experimental replicates. Means with the same letter above the bars are not significantly different at the 5% level by the least significant difference tests.
ppj-oa-03-2024-0057f3.jpg
Fig. 4
Non-adapted bacteria-triggered hypersensitive cell death and in planta bacterial growth in Chinese cabbage leaves regulated by ambient light environment. (A) Relative electrolyte leakages (%) in the leaves inoculated by a non-adapted strain Bv5-4a.1 of Xanthomonas campestris pv. vesicatoria (Xcv) at 8 and 24 h under different light period regimes. (B) Non-adapted bacterial growth in the inoculated leaves under different light period regimes. The data are the means ± standard errors of the four independent experimental replicates. Means with the same letter above the bars are not significantly different at the 5% level by the least significant difference tests.
ppj-oa-03-2024-0057f4.jpg
Fig. 5
Non-adapted bacteria-triggered hypersensitive cell death (HCD) and in planta bacterial growth in Chinese cabbage leaves regulated by relative humidity (RH) environment. (A) Altered HCD and tissue discoloration in the leaves inoculated by a non-adapted strain Bv5-4a.1 of Xanthomonas campestris pv. vesicatoria (Xcv) under different RH regimes. White arrows, water-soaked areas; red arrows, HCD-occurred areas; green arrows, brownish discolored areas. (B) Relative electrolyte leakages (%) in the Xcv-inoculated leaves at 8 and 24 h under different RH regimes. (C) Non-adapted bacterial growth in the inoculated leaves under different RH regimes. The data are the means ± standard errors of the four independent experimental replicates. Means with the same letter above the bars are not significantly different at the 5% level by the least significant difference tests.
ppj-oa-03-2024-0057f5.jpg
Fig. 6
Abscisic acid (ABA)-regulated non-adapted bacteria-triggered hypersensitive cell death and in planta bacterial growth in Chinese cabbage leaves. (A) Relative electrolyte leakages (%) in the leaves inoculated by a non-adapted strain Bv5-4a.1 of Xanthomonas campestris pv. vesicatoria (Xcv) at 8 and 24 h after 1 day pretreatment with different concentrations (0, 5, 10, 20, 50 and 100 μM) of fluridone and ABA. (B) Non-adapted bacterial growth in the inoculated leaves pretreated with fluridone and ABA. The data are the means ± standard errors of the five independent experimental replicates. Means with the same letter above the bars are not significantly different at the 5% level by the least significant difference tests.
ppj-oa-03-2024-0057f6.jpg
Fig. 7
Proposed model for different responses of Chinese cabbage leaves to an adapted strain 8004 of Xanthomonas campestris pv. campestris (Xcc) and a non-adapted strain Bv5-4a.1 of X. campestris pv. vesicatoria (Xcv). Syringe-inoculation with a high titer (107 cfu/ml) of Xcc 8004 led to bacterial proliferation within the leaf tissues at 24 h, when plant cells were not disintegrated. In contrast, the same titer (107 cfu/ml) of Xcv Bv5-4a.1 triggered hypersensitive cell death (HCD) in the leaf tissues, which can be altered by ambient environments such as light and wetness conditions as well as endogenous abscisic acid (ABA). Significantly elevated electrolytes, lipid peroxidation and defense gene expression, were found in the HCD-occurred leaves. The non-adapted bacterial cell proliferation was suppressed in the Chinese cabbage leaves during the establishment of HCD, which was comparable with Xcc growth. RH, relative humidity.
ppj-oa-03-2024-0057f7.jpg
Table 1
Nucleotide sequences of oligonucleotide primers of Chinese cabbage genes used for the quantitative RT-PCR in this study
Gene Protein product Accession no. Nucleotide sequence (5′ to 3′)
BrPR1 Pathogenesis-related protein 1 AY623008 F: GCTCAAGACAGTCCACAAG
R: GCCAAGTTCTCTCCGTAAG
BrPR4 Pathogenesis-related protein 4 AF528181 F: CCGCTAACGTAAGAGCAAC
R: CACAGAAAGCAGTCCAACC
BrChi1 Chitinase 1 JQ928641 F: CCGGAGATCCAACTGTTTC
R: GAAGCTCGGATAGGCATTAG
BrGST1 Glutathione S-transferase AY567976 F: AGACCAAGCCGTTGTTGAAG
R: AGGAATGTGGTGAAGATCGG
BrAPX Ascorbate peroxidase GQ500125 F: GCTATTGAGAAGTGCAGGAG
R: CCTAAGAGCAATGTGGAGAC
BrVSP2 Vegetative storage protein 2 EX103556 F: CTCACTTCCGACCAGTACC
R: TGTTTCTCAGTCCCGTATCC
BrAct7 Actin 7 JN120480 F: GGCTGTGTTCCCAAGTATC
R: CCCAGTTGCTCACAATACC

F, forward: R, reverse.

References

Abe, H., Ohnishi, J., Narusaka, M., Seo, S., Narusaka, Y., Tsuda, S. and Kobayashi, M. 2008. Function of jasmonate in response and tolerance of Arabidopsis to thrip feeding. Plant Cell Physiol. 49:68-80.
crossref pmid
Abe, H., Shimoda, T., Ohnishi, J., Kugimiya, S., Narusaka, M., Seo, S., Narusaka, Y., Tsuda, S. and Kobayashi, M. 2009. Jasmonate-dependent plant defense restricts thrips performance and preference. BMC Plant Biol. 9:97.
crossref pmid pmc
Adlung, N., Prochaska, H., Thieme, S., Banik, A., Blüher, D., John, P., Nagel, O., Schulze, S., Gantner, J., Delker, C., Stuttmann, J. and Bonas, U. 2016. Non-host resistance induced by the Xanthomonas effector XopQ is widespread within the genus Nicotiana and functionally depends on EDS1. Front. Plant Sci. 7:1796.
crossref pmid pmc
Ahammed, G. J., Li, X., Zhang, G., Zhang, H., Shi, J., Pan, C., Yu, J. and Shi, K. 2018. Tomato photorespiratory glycolate-oxidase-derived H2O2 production contributes to basal defence against Pseudomonas syringae. Plant Cell Environ. 41:1126-1138.
crossref pmid pdf
Ali, S., Ganai, B. A., Kamili, A. N., Bhat, A. A., Mir, Z. A., Bhat, J. A., Tyagi, A., Islam, S. T., Mushtaq, M., Yadav, P., Rawat, S. and Grover, A. 2018. Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol. Res. 212-213:29-37.
crossref
Arve, L. E., Kruse, O. M. O., Tanino, K. K., Olsen, J. E., Futsæther, C. and Torre, S. 2015. Growth in continuous high air humidity increases the expression of CYP707A-genes and inhibits stomatal closure. Environ. Exp. Bot. 115:11-19.
crossref
Ayliffe, M. and Sørensen, C. K. 2019. Plant nonhost resistance: paradigms and new environments. Curr. Opin. Plant Biol. 50:104-113.
crossref pmid
Cao, F. Y., Yoshioka, K. and Desveaux, D. 2011. The roles of ABA in plant-pathogen interactions. J. Plant Res. 124:489-499.
crossref pmid pdf
Cao, H.-H., Liu, H.-R., Zhang, Z.-F. and Liu, T.-X. 2016. The green peach aphid Myzus persicae perform better on pre-infested Chinese cabbage Brassica pekinensis by enhancing host plant nutritional quality. Sci. Rep. 6:21954.
crossref pmid pmc pdf
Chiesa, M. A., Roeschlin, R. A., Favaro, M. A., Uviedo, F., Campos-Beneyto, L., D’Andrea, R., Gadea, J. and Marano, M. R. 2019. Plant responses underlying nonhost resistance of Citrus limon against Xanthomonas campestris pv. campestris. Mol. Plant Pathol. 20:254-269.
crossref pmid pdf
Choudhary, A., Gupta, A., Ramegowda, V. and Senthil-Kumar, M. 2017. Transcriptomic changes under combined and nonhost bacteria reveal novel and robust defenses in Arabidopsis thaliana. Environ. Exp. Bot. 139:152-164.
Dalla Pria, M., Christiano, R. C. S., Furtado, E. L., Amorim, L. and Bergamin Filho, A. 2006. Effect of temperature and leaf wetness duration on infection of sweet oranges by Asiatic citrus canker. Plant Pathol. 55:657-663.
crossref
Daurelio, L. D., Petrocelli, S., Blanco, F., Holuigue, L., Ottado, J. and Orellano, E. G. 2011. Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco. J. Plant Physiol. 168:382-391.
crossref pmid
Daurelio, L. D., Romero, M. S., Petrocelli, S., Merelo, P., Cortadi, A. A., Talón, M., Tadeo, F. R. and Orellano, E. G. 2013. Characterization of Citrus sinensis transcription factors closely associated with the non-host response to Xanthomonas campestris pv. vesicatoria. J. Plant Physiol. 170:934-942.
crossref pmid
de Souza Yop, G., Gair, L. H. V., da Silva, V. S., Machado, A. C. Z., Santiago, D. C. and Tomaz, J. P. 2023. Abscisic acid is involved in the resistance response of Arabidopsis thaliana against Meloidogyne paranaensis. Plant Dis. 107:2778-2783.
crossref pmid
de Vleesschauwer, D., Yang, Y., Cruz, C. V. and Höfte, M. 2010. Abscisic acid-induced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice involves MAP kinase-mediated repression of ethylene signaling. Plant Physiol. 152:2036-2052.
crossref pmid pmc pdf
Delventhal, R., Rajaraman, J., Stefanato, F. L., Rehman, S., Aghnoum, R., McGrann, G. R. D., Bolger, M., Usadel, B., Hedley, P. E., Boyd, L., Niks, R. E., Schweizer, P. and Schffrath, U. 2017. A comparative analysis of nonhost resistance across the two Triticeae crop species wheat and barley. BMC Plant Biol. 17:232.
crossref pmid pmc pdf
Desurmont, G. A., Xu, H. and Turlings, T. C. J. 2016. Powdery mildew suppresses herbivore-induced plant volatiles and interferes with parasitoid attraction in Brassica rapa. Plant Cell Environ. 39:1920-1927.
crossref pmid
Dong, X., Yi, H., Lee, J., Nou, I.-S., Han, C.-T. and Hur, Y. 2015. Global gene-expression analysis to identify differentially expressed genes critical for the heat stress response in Brassica rapa. PLoS ONE 10:e0130451.
crossref pmid pmc
Farahani, A. S. and Taghavi, M. 2016. Changes of antioxidant enzymes of mung bean [Vigna radiata (L.) R. Wilczek] in response to host and non-host bacterial pathogens. J. Plant Prot. Res. 56:95-99.
crossref
Fonseca, J. P. and Mysore, K. S. 2019. Genes involved in nonhost disease resistance as a key to engineer durable resistance in crops. Plant Sci. 279:108-116.
crossref pmid
Franco, F. P., Moura, D. S., Vivanco, J. M. and Silva-Filho, M. C. 2017. Plant-insect-pathogen interactions: a naturally complex ménage à trois. Curr. Opin. Microbiol. 37:54-60.
crossref pmid
Gao, C., Xu, H., Huang, J., Sun, B., Zhang, F., Savage, Z., Duggan, C., Yan, T., Wu, C-h, Wang, Y., Vleeshouwers, V. G. A. A., Kamoun, S., Bozkurt, T. O. and Dong, S. 2020. Pathogen manipulation of chloroplast function triggers a light-dependent immune recognition. Proc. Natl. Acad. Sci. U. S. A. 117:9613-9620.
crossref pmid pmc
Griebel, T. and Zeier, J. 2008. Light regulation and daytime dependency of inducible plant defenses in Arabidopsis: phytochrome signalling controls systemic acquired resistance rather than local defense. Plant Physiol. 147:790-801.
crossref pmid pmc
Gupta, K. J., Brotman, Y., Segu, S., Zeier, T., Zeier, J., Persijn, S. T., Cristescu, S. M., Harren, F. J. M., Bauwe, H., Fernie, A. R., Kaiser, W. M. and Mur, L. A. J. 2013. The form of nitrogen nutrition affects resistance against Pseudomonas syringae pv. phaseolicola in tobacco. J. Exp. Bot. 64:553-568.
crossref pmid
Hammond-Kosack, K. E., Silverman, P., Raskin, I. and Jones, J. D. G. 1996. Race-specific elicitors of Cladosporium fulvum induce changes in cell morphology and the synthesis of ethylene and salicylic acid in tomato plants carrying the corresponding Cf disease resistance gene. Plant Physiol. 110:1381-1394.
crossref pmid pmc
Han, Z., Xiong, D., Schneiter, R. and Tian, C. 2023. The function of plant PR1 and other members of the CAP protein superfamily in plant-pathogen interactions. Mol. Plant Pathol. 24:651-668.
pmid pmc
He, P., Chintamanani, S., Chen, Z., Zhu, L., Kunkel, B. N., Alfano, J. R., Tang, X. and Zhou, J.-M. 2004. Activation of a COI1-dependent pathway in Arabidopsis by Pseudomonas syringae type III effectors and coronatine. Plant J. 37:589-602.
crossref pmid
Hwang, I. S., Choi, D. S., Kim, N. H., Kim, D. S. and Hwang, B. K. 2014. Pathogenesis-related protein 4b interacts with leucine-rich repeat protein 1 to suppress PR4b-triggered cell death and defense response in pepper. Plant J. 77:521-533.
pmid
Iqbal, Z., Iqbal, M. S., Hashem, A., Abd_Allah, E. F. and Ansari, M. I. 2021. Plant defense responses to biotic stress and its interplay with fluctuating dark/light conditions. Front. Plant Sci. 12:631810.
crossref pmid pmc
Ishibashi, K., Naito, S., Meshi, T. and Ishikawa, M. 2009. An inhibitory interaction between viral and cellular proteins underlies the resistance of tomato to nonadapted tobamoviruses. Proc. Natl. Acad. Sci. U. S. A. 106:8778-8783.
crossref pmid pmc
Ishiga, Y., Ishiga, T., Ikeda, Y., Matsuura, T. and Mysore, K. S. 2016. NADPH-dependent thioredoxin reductase C plays a role in nonhost disease resistance against Pseudomonas syringae pathogens by regulating chloroplast-generated reactive oxygen species. PeerJ 4:e1938.
crossref pmid pmc pdf
Jambunathan, N., Siani, J. M. and McNellis, T. W. 2001. A humidity-sensitive Arabidopsis copine mutant exhibits precocious cell death and increased disease resistance. Plant Cell 13:2225-2240.
crossref pmid pmc
Kang, L., Li, J., Zhao, T., Xiao, F., Tang, X., Thilmony, R., He, S. and Zhou, J.-M. 2003. Interplay of the Arabidopsis nonhost resistance gene NHO1 with bacterial virulence. Proc. Natl. Acad. Sci. U. S. A. 100:3519-3524.
crossref pmid pmc
Kay, S. and Bonas, U. 2009. How Xanthomonas type III effectors manipulate the host plant. Curr. Opin. Microbiol. 12:37-43.
crossref pmid
Keppler, L. D. and Novacky, A. 1986. Involvement of membrane lipid peroxidation in the development of a bacterially induced hypersensitive reaction. Phytopathology 76:104-108.
crossref
Kettles, G. J., Bayon, C., Canning, G., Rudd, J. J. and Kanyuka, K. 2017. Apoplastic recognition of multiple candidate effectors from the wheat pathogen Zymoseptoria tritici in the nonhost plant Nicotiana benthamiana. New Phytol. 213:338-350.
crossref pmid pdf
Kim, N. H. and Hwang, B. K. 2015. Pepper pathogenesis-related protein 4c is a plasma membrane-localized cysteine protease inhibitor that is required for plant cell death and defense signalling. Plant J. 81:81-94.
pmid
Kim, W., Prokchorchik, M., Tian, Y., Kim, S., Jeon, H. and Segonzac, C. 2020. Perception of unrelated microbe-associated molecular patterns triggers conserved yet variable physiological and transcriptional changes in Brassica rapa ssp. pekinensis. Hortic. Res. 7:186.
crossref pmid pmc pdf
Kim, Y. J., Lee, Y. H., Lee, H.-J., Jung, H. and Hong, J. K. 2015. H2O2 production and gene expression of antioxidant enzymes in Chinese cabbage (Brassica rapa var. glabra Regel) seedlings regulated by plant development and nitrosative stress-triggered cell death. Plant Biotechnol. Rep. 9:67-78.
crossref pdf
Klement, Z., Bozsó, Z., Ott, P. G., Kecskés, M. L. and Rudolph, K. 1999. Symptomless resistant response instead of the hypersensitive reaction in tobacco leaves after infiltration of heterologous pathovars of Pseudomonas syringae. J. Phytopathol. 147:467-475.
crossref
Krzymowska, M., Konopka-Postupolska, D., Sobczak, M., Macioszek, V., Ellis, B. E. and Henning, J. 2007. Infection of tobacco with different Pseudomonas syringae pathovars leads to distinct morphotypes of programmed cell death. Plant J. 50:253-264.
crossref pmid
Lajeunesse, G., Roussin-Léveillée, C., Boutin, S., Fortin, É, Laforest-Lapointe, I. and Moffett, P. 2023. Light prevents pathogen-induced aqueous microenvironments via potentiation of salicylic acid signalling. Nat. Commun. 14:713.
pmid pmc
Lee, H.-A., Kim, S.-Y., Oh, S.-K., Yeom, S.-I., Kim, S.-B., Kim, M.-S., Kamoun, S. and Choi, D. 2014. Multiple recognition of RXLR effectors is associated with nonhost resistance of pepper against Phytophthora infestans. New Phytol. 203:926-938.
pmid pmc
Lee, S., Ishiga, Y., Clermont, K. and Mysore, K. S. 2013. Coronatine inhibits stomatal closure and delays hypersensitive response cell death induced by nonhost bacterial pathogens. PeerJ 1:e34.
crossref pmid pmc
Lee, S., Vemanna, R. S., Oh, S., Rojas, C. M., Oh, Y., Kaundal, A., Kwon, T., Lee, H.-K., Senthil-Kumar, M. and Mysore, K. S. 2022a. Functional role of formate dehydrogenase 1 (FDH1) for host and nonhost disease resistance against bacterial pathogens. PLoS ONE 17:e0264917.
crossref pmid
Lee, S., Whitaker, V. M. and Hutton, S. F. 2016. Mini review: potential applications of non-host resistance for crop improvement. Front. Plant Sci. 7:997.
crossref pmid pmc
Lee, Y. H. and Hong, J. K. 2012. Host and non-host disease resistances of kimchi cabbage against different Xanthomonas campestris pathovars. Plant Pathol. J. 28:322-329.
crossref
Lee, Y. H. and Hong, J. K. 2015. Differential defence responses of susceptible and resistant kimchi cabbage cultivars to anthracnose, black spot and black rot diseases. Plant Pathol. 64:406-415.
crossref
Lee, Y. H., Kim, Y. J., Choi, H. W., Kim, Y.-H. and Hong, J. K. 2022b. Sodium nitroprusside pretreatment alters responses of Chinese cabbage seedlings to subsequent challenging stresses. J. Plant Interact. 17:206-219.
crossref
Leon-Reyes, A., Du, Y., Koornneef, A., Proietti, S., Körbes, A. P., Memelink, J., Pieterse, C. M. J. and Ritsema, T. 2010. Ethylene signaling renders the jasmonate response of Arabidopsis insensitive to future suppression by salicylic acid. Mol. Plant-Microbe Interact. 23:187-197.
crossref pmid
Li, H., Mahmood, T., Antony, G., Lu, N., Pumphreys, M., Gill, B., Kang, Z., White, F. F. and Bai, J. 2017a. The non-host pathogen Puccinia triticina elicits an active transcriptional response in rice. Eur. J. Plant Pathol. 147:553-569.
crossref pdf
Li, L., Li, R.-F., Ming, Z.-H., Lu, G.-T. and Tang, J.-L. 2017b. Identification of a novel type III secretion-associated outer membrane-bound protein from Xanthomonas campestris pv. campestris. Sci. Rep. 7:42724.
crossref pmid pdf
Li, T., Zhou, J. and Li, J. 2023. Combined effects of temperature and humidity on the interaction between tomato and Botrytis cinerea revealed by integration of histological characteristics and transcriptome sequencing. Hortic. Res. 10:uhac257.
crossref pmid pdf
Liu, Y., Mahmud, M. R., Xu, N. and Liu, J. 2022. The Pseudomonas syringae effector AvrPtoB targets abscisic acid signaling pathway to promote its virulence in Arabidopsis. Phytopathol. Res. 4:5.
crossref pdf
Long, Q., Xie, Y., He, Y., Li, Q., Zou, X. and Chen, S. 2019. Abscisic acid promotes jasmonic acid accumulation and plays a key role in citrus canker development. Front. Plant Sci. 10:1634.
crossref pmid pmc
Lu, M., Tang, X. and Zhou, J.-M. 2001. Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. Plant Cell 13:437-447.
crossref pmid pmc
Lummerzheim, M., de Oliveira, D., Castresana, C., Miguens, F. C., Louzada, E., Roby, D., Van Montagu, M. and Timmerman, B. 1993. Identification of compatible and incompatible interactions between Arabidopsis thaliana and Xanthomonas campestris pv. campestris and characterization of the hypersensitive response. Mol. Plant-Microbe Interact. 6:532-544.
crossref
Luo, Q., Wang, J., Wang, P., Liang, X., Li, J., Wu, C., Fang, H., Ding, S., Shao, S. and Shi, K. 2023. Transcriptomic and genetic approaches reveal that low-light-induced disease susceptibility is related to cellular oxidative stress in tomato. Hortic. Res. 10:uhad173.
crossref pmid pmc pdf
Ma, H., Xiang, G., Li, Z., Wang, Y., Dou, M., Su, L., Yin, X., Liu, R., Wang, Y. and Xu, Y. 2018. Grapevine VpPR10.1 functions in resistance to Plasmopara viticola through triggering a cell death-like defence response by interacting with VpVDAC3. Plant Biotechnol. J. 16:1488-1501.
pmid pmc
Mackey, D., Holt, B. F., Wiig, A. and Dangl, J. L. 2002. RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108:743-754.
crossref pmid
Metz, M., Dahlbeck, D., Morales, C. Q., Al Sady, B., Clark, E. T. and Staskawicz, B. J. 2005. The conserved Xanthomonas campestris pv. vesicatoria effector protein XopX is a virulence factor and suppresses host defense in Nicotiana benthamiana. Plant J. 41:801-814.
crossref pmid
Morales, G., Moragrega, C., Montesinos, E. and Llorente, I. 2018. Effects of leaf wetness duration and temperature on infection of Prunus by Xanthomonas arboricola pv. pruni. PLoS ONE 13:e0193813.
crossref pmid pmc
Morgham, A. T., Richardson, P. E., Essenberg, M. and Covers, E. C. 1988. Effects of continuous dark upon ultrastructure, bacterial populations and accumulation of phytoalexins during interactions between Xanthomonas campestris pv. malvacearum and bacterial blight susceptible and resistant cotton. Physiol. Mol. Plant Pathol. 32:141-162.
crossref
Mysore, K. S. and Ryu, C.-M. 2004. Non-host resistance: how much do we know? Trends Plant Sci. 9:97-104.
crossref pmid
Narusaka, Y., Narusaka, M., Seki, M., Ishida, J., Shinozaki, K., Nan, Y., Park, P., Shiraishi, T. and Kobayashi, M. 2005. Cytological and molecular analyses of non-host resistance of Arabidopsis thaliana to Alternaria alternata. Mol. Plant Pathol. 6:615-627.
crossref pmid
Oh, C., Heu, S., Yoo, J.-Y. and Cho, Y. 1999. An hrcU-homologous gene mutant of Xanthomonas campestris pv. glycines 8ra that lost pathogenicity on the host plant but was able to elicit the hypersensitive response on nonhosts. Mol. Plant-Microbe Interact. 12:633-639.
crossref pmid
Oh, S.-K., Lee, S., Chung, E., Park, J. M., Yu, S. H., Ryu, C.-M. and Choi, D. 2006. Insight into types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta 223:1101-1107.
crossref pmid pdf
Okamoto, M., Tanaka, Y., Abrams, S. R., Kamiya, Y., Seki, M. and Nambara, E. 2009. High humidity induces abscisic acid 8′-hydroxylase in stomata and vasculature to regulate local and systemic abscisic acid responses in Arabidopsis. Plant Physiol. 149:825-834.
crossref pmid pmc
Ontiveros, I., López-Moya, J. J. and Díaz-Pendón, J. A. 2022. Coinfection of tomato plants with Tomato yellow leaf curl virus and Tomato chlorosis virus affects the interaction with host and whiteflies. Phytopathology 112:944-952.
crossref pmid
Panchal, S., Chitrakar, R., Thompson, B. K., Obulareddy, N., Roy, D., Hambright, W. S. and Melotto, M. 2016. Regulation of stomatal defense by air relative humidity. Plant Physiol. 172:2021-2032.
crossref pmid pmc
Park, Y.-S., Jeon, M. H., Lee, S.-H., Moon, J. S., Cha, J.-S., Kim, H. Y. and Cho, T.-J. 2005. Activation of defense responses in Chinese cabbage by a nonhost pathogen, Pseudomonas syringae pv. tomato. J. Biochem. Mol. Biol. 38:748-754.
crossref pmid
Pečenková, T., Pejchar, P., Moravec, T., Drs, M., Haluška, S., Šantrůček, J., Potocká, A., Žárský, V. and Potocký, M. 2022. Immunity functions of Arabidopsis pathogenesis-related 1 are coupled but not confined to its C-terminus processing and trafficking. Mol. Plant Pathol. 23:664-678.
crossref pmid pmc pdf
Priller, J. P. R., Reid, S., Konein, P., Dietrich, P. and Sonnewald, S. 2016. The Xanthomonas campestris pv. vesicatoria type-3 effector XopB inhibits plant defence responses by interfering with ROS production. PLoS ONE 11:e0159107.
crossref pmid pmc
Qiu, J., Liu, Z., Xie, J., Lan, B., Shen, Z., Shi, H., Lin, F., Shen, X. and Kou, Y. 2022. Dual impact of ambient humidity on the virulence of Magnaporthe oryzae and basal resistance in rice. Plant Cell Environ. 45:3399-3411.
crossref pmid pdf
Raffeiner, M., Üstün, S., Guerra, T., Spinti, D., Fitzner, M., Sonnewald, S., Baldermann, S. and Börnke, F. 2022. The Xanthomonas type-III effector XopS stabilizes CaWRKY40a to regulate defense responses and stomatal immunity in pepper (Capsicum annuum). Plant Cell 34:1684-1708.
crossref pmid pmc pdf
Rani, T. S. and Podile, A. R. 2014. Extracellular matrix-associated proteome changes during non-host resistance in citrus-Xanthomonas interactions. Physiol. Plant 150:565-579.
pmid
Rani, T. S., Takahashi, D., Uemura, M. and Podile, A. R. 2015. Proteins associated with oxidative burst and cell wall strengthening accumulate during citrus-Xanthomonas non-host interaction. Plant Mol. Biol. Rep. 33:1349-1360.
crossref pdf
Schulze, S., Kay, S., Büttner, D., Egler, M., Eschen-Lippold, L., Hause, G., Krüger, A., Lee, J., Müller, O., Scheel, D., Szczesny, R., Thieme, F. and Bonas, U. 2012. Analysis of new type III effectors from Xanthomonas uncovers XopB and XopS as suppressors of plant immunity. New Phytol. 195:894-911.
crossref pmid pdf
Senthil-Kumar, M. and Mysore, K. S. 2013. Nonhost resistance against bacterial pathogens: retrospectives and prospects. Annu. Rev. Phytopathol. 51:407-427.
crossref pmid
Song, W., Ma, X., Tan, H. and Zhou, J. 2011. Abscisic acid enhances resistance to Alternaria solani in tomato seedlings. Plant Physiol. Biochem. 49:693-700.
crossref pmid
Sun, Z., Liu, Z., Zhou, W., Jin, H., Liu, H., Zhou, A., Zhang, A. and Wang, M.-Q. 2016. Temporal interactions of plant - insect - predator after infection of bacterial pathogen on rice plants. Sci. Rep. 6:26043.
crossref pmid pmc pdf
Uma, B., Rani, T. S. and Podile, A. R. 2011. Warriors at the gate that never sleep: non-host resistance in plants. J. Plant Physiol. 168:2141-2152.
crossref pmid
Üstün, S., Bartetzko, V. and Börnke, F. 2013. The Xanthomonas campestris type III effector XopJ targets the host cell proteasome to suppress salicylic-acid dediated plant defence. PLoS ONE 9:e1003427.
Verhage, A., Vlaardingerbroek, I., Raaymakers, C., Van Dam, N. M., Dicke, M., Van Wees, S. C. M. and Pieterse, C. M. J. 2011. Rewiring of the jasmonate signaling pathway in Arabidopsis during insect herbivory. Front. Plant Sci. 2:47.
crossref pmid pmc
Wang, C., Cai, X. and Zheng, Z. 2005. High humidity represses Cf-4/Avr4- and Cf-9/Avr9-dependent hypersensitive cell death and defense gene expression. Planta 222:947-956.
crossref pmid pdf
Wang, F., Yuan, S., Wu, W., Yang, Y., Cui, Z., Wang, H. and Liu, D. 2020. TaTLP1 interacts with TaPR1 to contribute to wheat defense responses to leaf rust fungus. PLoS Genet. 16:e1008713.
crossref pmid pmc
Weatherwax, S. C., Ong, M. S., Degenhardt, J., Bray, E. A. and Tobin, E. M. 1996. The interaction of light and abscisic acid in the regulation of plant gene expression. Plant Physiol. 111:363-370.
crossref pmid pmc pdf
Whalen, M. C., Stall, R. E. and Staskawicz, B. J. 1988. Characterization of a gene from a tomato pathogen determining hypersensitive resistance in non-host species and genetic analysis of this resistance in bean. Proc. Natl. Acad. Sci. U. S. A. 85:6743-6747.
crossref pmid pmc
Xu, J., Audenaert, K., Hofte, M. and De Vleesschauwer, D. 2013. Abscisic acid promotes susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv. oryzae by suppressing salicylic acid-mediated defences. PLoS ONE 8:e67413.
crossref pmid pmc
Yang, C.-W., Wang, J. W. and Kao, C. H. 2000. The relation between accumulation of abscisic acid and proline in detached rice leaves. Biol. Plant 43:301-304.
crossref
Yao, L., Jiang, Z., Wang, Y., Hu, Y., Hao, G., Zhong, W., Wan, S. and Xin, X.-F. 2023. High air humidity dampens salicylic acid pathway and NPR1 function to promote plant disease. EMBO J. 42:e113499.
pmid pmc
Zeier, J., Pink, B., Mueller, M. J. and Berger, S. 2004. Light conditions influence specific defence responses in incompatible plant-pathogen interactions: uncoupling systemic resistance from salicylic acid and PR-1 accumulation. Planta 219:673-683.
crossref pmid pdf
Zhou, F., Menke, F. L. H., Yoshioka, K., Moder, W., Shirano, Y. and Klessig, D. F. 2004. High humidity suppresses ssi4-mediated cell death and disease resistance upstream of MAP kinase activation, H2O2 production and defense gene expression. Plant J. 39:920-932.
crossref pmid
Zurbriggen, M. D., Carrillo, N., Tognetti, V. B., Melzer, M., Peisker, M., Hause, B. and Hajirezaei, M.-R. 2009. Chloroplast-generated reactive oxygen species play a major role in localized cell death during the non-host interaction between tobacco and Xanthomonas campestris pv. vesicatoria. Plant J. 60:962-973.
crossref pmid
TOOLS
METRICS Graph View
  • 1 Web of Science
  • 1 Crossref
  •  0 Scopus
  • 2,968 View
  • 134 Download
ORCID iDs

Jeum Kyu Hong
https://orcid.org/0000-0002-9161-511X

Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next