Plant Pathol J > Volume 40(5); 2024 > Article
Jia, Thinn, Kim, Min, and Oh: Capsicum annuum NAC4 (CaNAC4) Is a Transcription Factor with Roles in Biotic and Abiotic Stresses

Abstract

Transcription factors (TFs) regulate gene expression by binding to DNA. The NAC gene family in plants consists of crucial TFs that influence plant development and stress responses. The whole genome of Capsicum annuum shows over 100 NAC genes (CaNAC). Functional characteristics of the most CaNAC TFs are unknown. In this study, we identified CaNAC4, a novel NAC TF in C. annuum. CaNAC4 expression increased after inoculation with the pathogens, Xanthomonas axonopodis pv. vesicatoria race 3 and X. axonopodis pv. glycines 8ra, and following treatment with the plant hormones, salicylic acid and abscisic acid. We investigated the functional characteristics of the CaNAC4 gene and its roles in salt tolerance and anti-pathogen defense in transgenic Nicotiana benthamiana. For salt stress analysis, the leaf discs of wild-type and CaNAC4-transgenic N. benthamiana plants were exposed to different concentrations of sodium chloride. Chlorophyll loss was more severe in salt stress-treated wild-type plants than in CaNAC4-transgenic plants. To analyze the role of CaNAC4 in anti-pathogen defense, a spore suspension of Botrytis cinerea was used to infect the leaves. The disease caused by B. cinerea gradually increased in severity, and the symptoms were clearer in the CaNAC4-transgenic lines. We also investigated hypersensitive response (HR) in CaNAC4-transgenic plants. The results showed a stronger HR in wild-type plants after infiltration with the apoptosis regulator, BAX. In conclusion, our results suggest that CaNAC4 may enhance salt tolerance and act as a negative regulator of biotic stress in plants.

Plants are commonly exposed to a wide variety of environmental stressors that affect their productivity. A previous study has reported that in 2007, only 3.5% of the global land area was unaffected by environmental stresses (Cramer et al., 2011). Environmental stress can be grouped into two types: biotic and abiotic stress. Biotic stresses—including fungi, viruses, bacteria, oomycetes, nematodes, and parasitic plants—cause 26-38% of global food yield losses (Cerda et al., 2017; Strange and Scott, 2005). Abiotic stresses include salt stress, drought, and low and high temperatures, which are the main causes of agricultural productivity loss globally.
Plant-specific transcription factors (TFs) play a vital role in regulating plant development and the responses of plants to biotic and abiotic stresses (Lee et al., 2017; Yoon et al., 2020). Currently, the most widely studied TFs in plants include those in the NAC, AP2/EREBP, MYB, and WRKY families (Erpen et al., 2018; Nuruzzaman et al., 2013). The NAC gene family is one of the most important TF gene families in plants. The name NAC was initially obtained from the names of three proteins containing similar DNA-binding domains: the petunia NAM (no apical meristem), ATAF1 & 2 (Arabidopsis thaliana transcriptional activation factor), and CUC2 (cup-shaped cotyledon) (Han et al., 2020; Puranik et al., 2012; Tweneboah and Oh, 2017). With the development of genome sequencing technology and bioinformatics, more than 100 NAC TFs have been identified in various plants. For example, 106 NAC genes have been identified in Capsicum annuum (Kim et al., 2014), 117 in A. thaliana (Nuruzzaman et al., 2010), 74 in Vitis vinifera (Wang et al., 2013), 148 in Zea mays (Peng et al., 2015), and 104 in Solanum (Su et al., 2015). Moreover, 151 NAC TFs have been identified in Oryza sativa (Nuruzzaman et al., 2010), along with 152 in Nicotiana tabacum (Rushton et al., 2008).
A typical NAC protein usually contains a highly conserved N-terminal NAC domain and a diversified C-terminal domain (Nuruzzaman et al., 2013). The NAC domain of NAC TFs contains nearly 150-160 amino acids, and can be further separated into five subdomains (A-E) (Ooka et al., 2003). The C-terminus typically serves as a potential transcriptional regulator that can either increase or decrease transcription (Puranik et al., 2012).
Published literature indicates that several NAC genes are involved in regulating pathogen resistance and abiotic tolerance in plants. For example, in transgenic tobacco lines that overexpress LpNAC13 (a Lilium pumilum NAC TF), the TF negatively regulates drought tolerance and positively regulates the response to salt stress (Wang et al., 2020). In addition, PwNAC30—an NAC TF found in Picea wilsonii—reduces plant tolerance to drought and salt stress (Liang et al., 2020). Overexpression of the grapevine gene VvNAC08 in Arabidopsis results in markedly enhanced drought tolerance (Ju et al., 2020). HaNAC1 (an NAC TF from Haloxylon ammodendron) enhances tolerance to drought stress and upregulates the stress-response genes RD22, ERD11, P5CS1, NCED1, RD29a, and LEA3 (Gong et al., 2020). Liu et al. (2014) reported that treatment with the hormones salicylic acid (SA), jasmonate (JA), and 1-aminocyclopropanecarboxylic acid (ACC) induced the expression of the tomato TF, SISRN1. Using a virus-induced gene-silencing technique, the authors demonstrated that SISRN1 plays a positive role in plant defense against Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 (Liu et al., 2014). The TF GhATAF1 is isolated from cotton, and is induced by the plant hormones abscisic acid (ABA), JA, and methyl jasmonate (MeJA), as well as by abiotic stresses such as low temperatures and salt. GhATAF1-overexpressing plants upregulate stress-responsive genes (AVP1, RD22, DREB2A, LEA3, and LEA6) and JA- and SA-mediated signaling pathways, which provides them with enhanced salt tolerance and defenses against pathogens such as B. cinerea and Verticillium dahlia (He et al., 2016).
Kim et al. (2014) analyzed the whole-genome sequence of C. annuum and reported 106 NAC (CaNAC) TFs in the chili pepper genome, most of which are involved in pathogen responses and plant development processes. The CaNAC1 TF was first identified and functionally analyzed in 2005, and was reported to enhance plant defense responses against non-host pathogens (Oh et al., 2005). The CaNAC2 gene was found to be involved in enhancing tolerance to low temperatures and salt stress (Guo et al., 2015). Although the analysis of the whole-genome sequence in this species indicated the existence of hundreds of NAC TFs, few studies have examined their functions. Therefore, more studies are required in this area.
In this study, we successfully identified and characterized CaNAC4, a novel NAC family gene in C. annuum. The primary purpose of this study was to examine the functional roles of CaNAC4. To understand the functions of CaNAC4 under biotic and abiotic stresses, the phenotypes of CaNAC4-overexpressing Nicotiana benthamiana lines were compared with those of wild-type (WT) plants after treatment with biotic and abiotic stresses, including salt stress and infection with B. cinerea and Pseudomonas syringae pv. tabaci 11528 (Psta 11528). In addition, reverse-transcription polymerase chain reaction (RT-PCR) was performed to compare the expression levels of several defense response-related genes that may be regulated by CaNAC4.

Materials and Methods

Plant materials and growth conditions

The seeds of chili pepper (Capsicum annuum cv. Jindaegeon) were purchased from Asia Seed Co., Ltd. (Seoul, Korea), and N. benthamiana seeds were obtained from the Molecular Plant Fungal Pathology Laboratory, Chungnam National University. The seeds were planted in a greenhouse under a 16 h/8 h day/night photoperiod with 25°C average temperature and 65% average relative humidity. We used 5-6-week-old plants in this study (Wang et al., 2016).

Bacterial cultures and inoculation

The bacterial pathogens Xanthomonas axonopodis pv. vesicatoria race 3 (the causative agent of bacterial spots in pepper) and X. axonopodis pv. glycines 8ra (the soybean pustule pathogen) (Oh et al., 2005) were provided by the Molecular Plant Fungal Pathology Laboratory, Chungnam National University. The pathogens were cultured on solid yeast extract pectin (YEP; yeast extract, 10 g/l; peptone, 10 g/l; sodium chloride [NaCl], 5 g/l; agar, 15 g/l) medium by streaking and incubated at 28°C in dark conditions for 2 days. Following this, a single bacterial colony was inoculated into 25 ml YEP liquid medium using a sterile pipette tip and incubated at 28°C and 180 rpm for 30 h. The suspensions were then centrifuged at 3,000 rpm for 20 min at 25°C. The supernatant was removed and the residue was resuspended in 10 mM MgCl2 buffer until OD600 = 0.1. Pathogens were inoculated into chili pepper leaves as previously described (Oh et al., 2008). Pressure infiltration was performed on the underside of tobacco leaves using a 1,000 μl needleless syringe. Plants inoculated with 10 mM MgCl2 buffer were used as controls, and the treated plants were grown in a greenhouse. Samples were collected in 2 ml e-tubes at time intervals of 0, 1.5, 3, 6, 12, 24, 48, and 72 h after inoculation. The samples were directly snap-frozen in liquid nitrogen and stored at −70°C for further analysis.

cDNA synthesis and gene expression analysis

Total RNA was isolated from treated leaves using TRIzol reagent (Molecular Research Center Inc., Cincinnati, OH, USA). LeGene cDNA Synthesis Master Mix (LeGene Biosciences Inc., San Diego, CA, USA) was used for cDNA synthesis. Following the cDNA was used for standard PCR. The Actin gene (the housekeeping gene) was used as a standard to quantify the expression levels of each target gene. Finally, the PCR products were examined using 1.0% agarose gel electrophoresis (Rushton et al., 2008). All the primers used in this study are shown in Table 1. The densitometry data for band intensities was generated by analyzing the gel images on the Image J program version 1.53e (National Institutes of Health, Bethesda, MD, USA; http://rsb.info.nih.gov/ij/).

Chemical treatment and wounding

For the chemical treatment, SA (247588, Sigma-Aldrich, St. Louis, MO, USA) was dissolved in ddH2O at a concentration of 10 mM. ABA (100 μM, A1046, Sigma-Aldrich) was prepared. The chemical hormones were sprayed on the surface of the chili pepper plants. For wounding treatment, the chili pepper leaves were wounded by using the sterilized needleless syringe. The treated plants were harvested at different time points (0-24 h) after treatment. The samples were immediately frozen in liquid nitrogen and stored at −70°C for further study (Tyagi et al., 2014).

Cloning and sequence analysis of the CaNAC4 gene

Total RNA was isolated from the chili pepper plant, and reverse transcription was performed using a cDNA synthesis kit as described previously. The primers CaNAC4-F (TACCATGGATGGAGAAGGTTGATTTTGTG) and CaNAC4-R (TAACTAGTTTAAC GTTTTCTTAAAACTAG) were used to amplify the open reading frame (ORF) sequence of CaNAC4. Subsequently, the PCR amplification products were cloned into the pMD20-T vector using a TA cloning kit (Takara Bio Inc., Shiga, Japan). CaNAC4 was sequenced by Macrogen, Inc. (Seoul, Korea).

Phylogenetic analysis of the CaNAC4 gene

The FASTA sequence of CaNAC4 was used as a template for BLAST, and similar sequences were downloaded from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) and Arabidopsis Information Resource (http://www.arabidopsis.org/) websites. A phylogenetic tree was created using MEGA 7.0 (Yan et al., 2018). CLUSTAL W was used to perform multiple sequence alignment of the NAC genes, and phylogenetic analysis was performed using the neighbor-joining method and 1,000 bootstrap replicates.

Agrobacterium-mediated transformation of N. benthamiana

The CaNAC4-transgenic N. benthamiana line was developed as described by Wang et al. (2016) with some modifications. To construct the expression vector, the ORF of CaNAC4 was PCR-amplified using specific primers with restriction sites for XbaI and KpnI. The pCAMBIA2300 vector and the target fragments were double-digested with the XbaI and KpnI restriction enzymes, and the target fragment was ligated into the pCAMBIA2300 vector to construct the pCAMBIA2300-CaNAC4 super-expression vector. The leaf discs of the N. benthamiana plant were infected with GV3101 Agrobacterium suspension carrying pCAMBIA2300-CaNAC4 recombinant vector. The shoots were produced on the shoot-inducing medium, and the rooted plants were finally acclimatized in plotting soil. Seeds of the transformed plants were sterilized as described previously and then planted in Murashige & Skoog (MS) medium containing kanamycin (50 mg/l). the transformed plants were selected as the T1 generation plants.

Salt stress treatment of CaNAC4-transgenic plants

To determine the stable inheritance and role of the CaNAC4 gene under salt stress, T3 seeds were cultured on MS medium containing kanamycin (50 mg/l). After 7 days, budding seedlings were transplanted to MS medium containing 0, 100, and 200 mM NaCl. The roots and shoots of the WT and CaNAC4-transgenic tobacco lines were measured.
Healthy leaf discs were acquired from 4-week-old leaves that had been soaked in ddH2O for 2 h and then floated in a NaCl solution (100 and 200 mM) for 3 days. The traditional alcohol extraction method was used to extract the chlorophyll content of leaves (Kamble et al., 2015).

Biotic stress treatments of CaNAC4-transgenic plants

Botrytis cinerea

B. cinerea was cultured on V8 medium (V8 juice, 200 ml; agar, 15 g; CaCO3, 2.5 g; ddH2O, 800 ml) and incubated at 25°C for 7 days. The spore suspension was collected using sterile water and gauze, and adjust the concentration of the suspension to approximately 1 × 106 spores/ml. Four-week-old leaves were harvested from the CaNAC4-transgenic and WT plants, surface sterilized by soaking in 1% NaOCl for 2 min, and then washed in ddH2O three times. Following this, 10 μl of the spore solution was dropped on the detached leaves using a pipette. Finally, the treated leaves were stored in a sealed plastic box to maintain humidity. The symptoms of B. cinerea infection were checked daily and the size of the disease symptoms was measured simultaneously (Oh et al., 2014).

Pseudomonas syringae pv. tabaci 11528

We used 4-week-old WT and CaNAC4-transgenic lines and analyzed their pathogen tolerance against Psta 11528. Psta 11528 was cultured at liquid YEP medium, incubated at 180 rpm at 30°C for 2 days, and centrifuged at 12,000 rpm for 10 min. Next, the supernatant was discarded, the pellet was resuspended in 10 mM MgCl2 buffer, and the OD600 was adjusted to 0.1. The suspension of the bacterial solution was pressure-infiltrated into the leaves of WT and CaNAC4-transgenic plants using a 1,000 μl needleless syringe. The bacterial suspension was also infiltrated into tobacco plants placed under greenhouse conditions. Disease symptoms were checked and recorded with a camera after 3 days.
To estimate bacterial growth in the WT and CaNAC4-transgenic plants, the infiltrated leaves were harvested, sterilized using 70% ethanol for 1 min, and washed in ddH2O three times. The leaf discs were disinfected, ground in 10 mM MgCl2 using a sterile pestle, and centrifuged at 3,500 rpm for 5 min. Following this, 10 μl of the supernatant was transferred into a new tube and diluted 10 times using sterile water. The diluted bacterial suspension (2 μl) was spread on YEP medium containing the appropriate antibiotics, and the culture was incubated at 30°C for 3 days. The bacterial colony-forming units (cfu) were counted, and the experiment was repeated at least thrice (Tyagi et al., 2014; Wang et al., 2016).

The apoptosis regulator BAX

BAX (Bcl-2-associated X protein) is a death-promoting member of the Bcl-2 gene family, and can trigger cell death when expressed in plants (Zhao et al., 2014). The BAX protein was acquired from the Molecular Plant Fungal Pathology Laboratory at Chungnam National University and transformed into Agrobacterium. Agroinfiltration was performed as described in Psta 11528, and a needleless syringe (1,000 l) was used to inject the solution into the leaves of 4-week-old tobacco plants. The BAX-infiltrated plants were kept in a greenhouse for 3 days under the conditions described previously, and the symptoms of cell death were recorded. The BAX-infiltrated leaves were collected into a 1.5 ml tube and kept −70°C for further gene expression analysis.

Results

Expression of CaNAC4 in chili pepper following pathogen inoculation

To investigate the possible roles of CaNAC4 in resistance against pathogens, we investigated the expression pattern of CaNAC4 after infiltrating chili plants with the non-host incompatible pathogen X. axonopodis pv. glycines 8ra and the compatible pathogen X. axonopodis pv. vesicatoria race 3. The control plants were infiltrated with buffer MgCl2. For gene expression analysis, the housekeeping gene actin was used as a control. The pathogenesis-related protein 1 (PR-1) gene was used as a positive control because it is expressed at high levels during infection by various pathogens. The results showed that when chili pepper plants were infiltrated with buffer MgCl2, there were no significant changes in the expression level of CaNAC4 in chili pepper plants (Fig. 1A and D). After inoculation with the compatible pathogen X. axonopodis pv. vesicatoria race 3, the transcription levels of CaNAC4 increased from 1.5 h after inoculation (hai), peaked at 3 hai, and later the expression level decreased (Fig. 1B and D). After inoculation with the incompatible pathogen X. axonopodis pv. glycines 8ra, the expression level of CaNAC4 increased at 1.5 hai, and peaked at 72 hai (Fig. 1C and D). These results indicated that CaNAC4 expression is induced by both types of pathogens, suggesting that CaNAC4 plays a role in the response to both compatible and incompatible pathogens.

Expression of CaNAC4 after chemical treatment and wounding in chili pepper

Previous studies have indicated that during biotic stress, most NAC TFs elicit plant defense responses through the SA or JA signaling pathways and activate stress-responsive genes to impact plant stress tolerance through the ABA or JA signaling pathways. The transcriptional expression of the CaNAC4 gene was investigated after treating chili pepper plants with SA and ABA. The results showed that when treated with 5 mM SA, CaNAC4 gene expression changed, and peaked 12 h after treatment (Fig. 2A and D). The transcription level of CaNAC4 increased since 0.5 h after treatment with 100 μl ABA, and peaked at 9 h (Fig. 2B and D). After wounding the chili leaves, CaNAC4 expression levels gradually increased after 0.5 h treatment and peaked at 12 hai (Fig. 2C and D). These results indicate that the expression of the CaNAC4 gene was activated by the phytohormones ABA and SA and by wounding.

Phylogenetic analysis of CaNAC4

NAC family genes have been comprehensively studied in O. sativa and the model plant Arabidopsis thaliana (ANACs). NAC family proteins can be classified into two groups and 18 subgroups (Ooka et al., 2003). We used MEGA 7.0 to perform phylogenetic analysis using the nucleic acid sequence of CaNAC4 and other known sequences from O. sativa and A. thaliana. The results showed that CaNAC4 clustered with ANAC011 and was highly homologous to CaNAC083 (Fig. 3A).
The protein sequences of CaNAC4 were transcribed based on the nuclear sequence, and the sequences of ANAC071, ANAC096, ANAC011, ANAC045, ANAC086, ANAC028, ANAC057, ANAC020, and CaNAC083 were downloaded from NCBI. These were aligned using Clustal W, and clustered in the same subgroup as ANAC011. The alignment results demonstrated that the N-terminus had a conserved NAC domain and could be further separated into five subdomains (A, B, C, D, and E) (Fig. 3B). Furthermore, subdomains A, C, and D were found to be conserved, whereas subdomains B and E were relatively divergent.

CaNAC4-transgenic lines show enhanced salt tolerance

To evaluate the function of CaNAC4 in tolerance to salinity stress, we used Agrobacterium-mediated transformation to overexpress the CaNAC4 gene in tobacco. Five transgenic lines were generated, of which lines 2 and line 3 showed stable expression in T3 seeds and were used for subsequent experiments. One-week-old tobacco plants were transplanted to MS medium containing different concentrations of NaCl. After 7 days, no differences were observed between the WT and CaNAC4-transgenic lines when plants were grown on MS medium without salt stress (Fig. 4A-C). When grown on MS medium containing NaCl (100 and 200 mM), WT tobacco plants were severely repressed, especially at 200 mM. The CaNAC4-transgenic lines showed tolerance to salinity stress. The roots and shoots of CaNAC4-transgenic lines were approximately twice as long as those of the WT plants (Fig. 4A-C).
Leaf discs from 4-week-old CaNAC4-overexpressing and WT tobacco plants were soaked in NaCl solutions (100 and 200 mM) for 7 days. In the leaf discs from WT plant, the color started to recede from green to white, especially in those soaked in 200 mM NaCl. However, the leaf discs from CaNAC4-transgenic lines did not show any significant change in color (Fig. 4D). We investigated the chlorophyll content of leaf discs after salt treatment. The salt stress-induced loss of chlorophyll content was lower in CaNAC4-transgenic lines than in WT plants (Fig. 4E). Taken together, these results indicate that the CaNAC4 gene enhances tolerance to salt stress in transgenic tobacco plants.

CaNAC4-transgenic N. benthamiana plants show higher levels of B. cinerea infection

The necrotrophic pathogen, B. cinerea, was used to investigate the role of CaNAC4 in response to pathogen stress. We found that the disease symptoms were milder in WT plants than in the CaNAC4-overexpressing lines. The disease caused by B. cinerea gradually increased in severity, and symptoms became clearer in CaNAC4-transgenic lines. Accordingly, the average diameters of necrotic lesions were recorded at approximately 0.50 cm in WT plants and at approximately 0.65-0.75 cm in CaNAC4-transgenic lines (Fig. 5A and B). These results illustrate that CaNAC4 may be a negative regulator of plant defense responses against the necrotrophic B. cinerea.
To examine how CaNAC4 reduces the defense responses to necrotrophic fungi, we measured the expression levels of defense-related genes in CaNAC4-transgenic lines using RT-PCR. Previous research has shown that in plant cells, genes encoding antioxidant metabolic enzymes—such as ascorbate glutathione peroxidase (GPX), peroxidase (APX), glutathione S-transferase (GST), catalase (CAT), and superoxide dismutase (SOD)—are involved in defense responses and the scavenging of reactive oxygen species (ROS). In the WT N. benthamiana plant, we found that the transcript levels of NbCAT3, NbGST1, and NbSOD3 were induced after inoculation with B. cinerea. And after infected the B. cinere, there genes expression level was lower in the CaNAC4-transgenic lines compared with the WT. But the expression levels of NbAPX1 did not change in CaNAC4-transgenic or WT lines (Fig. 5C).

CaNAC4-transgenic plants react negatively to Psta 11528 infection

Psta 11528 causes wild-fire disease in tobacco plants. To examine the role of CaNAC4 against Psta 11528 infection in tobacco plants, we infiltrated a Psta 11528 suspension into the WT and CaNAC4-overexpression lines and monitored the disease symptoms. After 3 days, the symptoms of Psta 11528 infection were distinctive in the CaNAC4-transgenic lines. In contrast, the expansion of the disease was delayed in the WT plants (Fig. 6A). The infiltrated leaves were incubated on YEP medium containing rifampicin for 30 h at 30°C, and the cfus on these leaves were counted. The average number of cfus was significantly higher in CaNAC4-transgenic lines than in WT plants (Fig. 6B). Moreover, we examined the expression levels of defense-related genes in the leaves of CaNAC4-transgenic and WT tobacco plants inoculated with Psta 11528. In the WT N. benthamiana plant, we observed that the transcript levels of NbCAT3, NbGST1, and NbSOD3 were elevated following inoculation with Psta 11528. Moreover, post-infection with Psta 11528, the expression levels of these genes were diminished in the CaNAC4-transgenic lines compared to the WT, although the expression levels of NbAPX1 did not change significantly (Fig. 6C).

CaNAC4-transgenic plants inhibit BAX-induced cell death

BAX is a cell death-promoting protein in mammalian cells that can also trigger cell death when expressed in plants (Baek et al., 2004). In this study, we infiltrated CaNAC4-transgenic and WT tobacco plants with BAX at a concentration of OD600 = 0.1. After 3 days of infiltration, the symptoms of cell death were checked. The results showed that cell death symptoms were suppressed in CaNAC4-transgenic plants (Fig. 7A).
The RT-PCR results indicated that the expression level of NbGST which is involved in defense responses. However, the transcript levels of NbAPX1, NbSOD3 were not significantly different in the CaNAC4-transgenic and WT lines (Fig. 7B).

Discussion

Plant-specific NAC TFs are among the largest families of TFs in the plant kingdom and play a crucial role in biotic stress response and abiotic stress tolerance (Han et al., 2020; Liang et al., 2020; Wang et al., 2020). The functional analysis of NAC genes has largely been conducted in other plant species, such as rice, tomato, and maize (Lu et al., 2015; Shen et al., 2017; Wang et al., 2016). However, only a few NAC genes and their functions have been studied in detail in C. annuum (Guo et al., 2015; Kim et al., 2014; Oh et al., 2005; Zhang et al., 2020). Extensive research on gene functions is required for the collection of adequate information on breeding strategies. In the current study, we identified CaNAC4, which is a novel NAC TF in C. annuum.
Recently, whole-genome analyses of C. annuum have indicated the existence of more than 100 NAC genes in this species. These genes can be classified into three main groups (Groups I, II, and III), which can be further divided into 14 subgroups in Group I, 4 subgroups in Group II, and 1 Solanaceae-specific NAC in Group III (Diao et al., 2018; Qin et al., 2014). Phylogenetic analysis revealed that CaNAC4 clustered in Group I within the ANAC011 subgroup (Fig. 3A). Protein sequence alignment revealed that there were only two amino acids that differed between CaNAC4 and CaNAC083, which shows that CaNAC4 has a conserved N-terminal NAC domain. Furthermore, the conserved N-terminal region contained five subdomains (A, B, C, D, and E). Further analysis indicated that subdomains A, C, and D were conserved, whereas subdomains B and E were relatively divergent (Fig. 3B). These results demonstrated that CaNAC4 is a C. annuum TF (CaNAC).
In C. annuum, the expression of CaNAC1 can be induced through treatment with phytohormones (SA, ethylene, and JA) and inoculation with pathogens (Oh et al., 2005). CaNAC2 is involved in plant responses to salt and cold stresses, and CaNAC2 expression is induced by SA and ABA (Guo et al., 2015). Transcription of CaNAC035 is induced by gibberellic acid, MeJA, SA, and ABA, which play positive roles in abiotic stresses (Zhang et al., 2020). In this study, the RT-PCR results demonstrated that the expression levels of CaNAC4 were elevated by ABA, SA, wounding treatment, and inoculation with pathogens (X. axonopodis pv. vesicatoria race 3 and X. axonopodis pv. glycines 8ra). Accordingly, we predicted that CaNAC4 is involved in biotic and abiotic stress responses in these plants.
To evaluate the functions of CaNAC4, we transferred the CaNAC4 gene into N. benthamiana. the results suggest that CaNAC4 plays a positive role in tobacco plants under salt stress (Fig. 4). Previous studies have reported that NAC TFs generally regulate abiotic stress through ABA-dependent and/or ABA-independent signaling pathways (Puranik et al., 2012; Shen et al., 2017; Tran et al., 2004). In this study, the transcription levels of CaNAC4 were increased by treatment with ABA and SA. Therefore, we speculate that the CaNAC4 gene may be involved in response to biotic stress, likely through the ABA-dependent and/or SA-dependent pathways; however, this still needs to be confirmed in future studies.
To elucidate the role of CaNAC4 in biotic stress, we inoculated tobacco leaves with the necrotrophic fungus B. cinerea and the bacterium Psta 11528. Wang et al. (2009) demonstrated that ATAF1, a drought-inducible gene in Arabidopsis belonging to the NAC family, acts as a negative regulator of plant defense responses to B. cinerea and Pst DC3000. Furthermore, Liu et al. (2014) found that the Solanum lycopersicum Stress-related NAC1 (SISRN1) TF exacerbates disease severity caused by Pst DC3000 and B. cinerea. In the present study, we found that the CaNAC4-overexpressing tobacco lines showed increased symptoms of the disease caused by B. cinerea (Fig. 5A and B). RT-PCR demonstrated that the expression levels of NbGST1, NbSOD3, and NbCAT3 were induced after inoculation with B. cinerea compared with the non-infected plant, but the level of induced was inhibited in the transgenic lines (Fig. 5C). The number of Psta 11528 in the leaves of CaNAC4-overexpressing lines also increased following incubation with the pathogen (Fig. 6A and B). Moreover, RT-PCR indicated that the expression levels of NbGST1, NbSOD3, and NbCAT3 were increased after infection with Psta 11528 compared with the non-infected WT N. benthamiana plant. However, these gene expression levels were lower in the CaNAC4-overexpressing lines (Fig. 6C). These results suggest that CaNAC4 plays a negative role in responses to biotic stress. The GST, SOD, CAT, and GPX genes encode antioxidant metabolic enzymes and play key roles in scavenging ROS to maintain ROS balance in plants (Han et al., 2020; Tyagi et al., 2014). Based on our results, we infer that CaNAC4 reduces the scavenging capability of plants by downregulating scavenging enzymes such as GST, SOD, and CAT. As a result, the high level of production of ROS increases the disease susceptibility of plants.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This work was supported by the National Research Foundation of Korea (NRF) funded by the MEST (NRF-2017R1D1A1B03035692).

Fig. 1
Expression of CaNAC4 after pathogen inoculation in chili pepper. The chili pepper plants were infiltrated with 10 mM MgCl2 (A), Xanthomonas axonopodis pv. vesicatoria race3 (B), and X. axonopodis pv. glycine 8ra (C). Total RNA was extracted from the infiltrated leaves of the tobacco plants, and reverse-transcription polymerase chain reaction was used to analyze the gene expression level. The housekeeping gene CaActin was used as control, and the pathogenesis-related protein 1 (CaPR-1) gene was used as the positive marker. Band intensity of CaNAC4/CaACtin and CaPR-1/CaActin were checked to represent expression levels under different conditions. (D) CaNAC4 relative expression level. (E) CaPR-1 relative expression level.
ppj-oa-07-2024-0104f1.jpg
Fig. 2
Expression of CaNAC4 after chemical treatment and wounding in chili pepper. The chili pepper leaves were treated with 5 mM salicylic acid (SA) (A), 100 μm abscisic acid (ABA) (B), and wounding (C). Total RNA was extracted from the infiltrated leaves, and reverse-transcription polymerase chain reaction was used to analyze the gene expression level. The housekeeping gene CaActin was used as control, and pathogenesis-related protein 1 (CaPR-1) and proteinase inhibitor II (CaPIN2) gene were used as positive markers. Band intensity of CaNAC4/CaACtin and CaPR-1/CaActin or CaPIN2/CAactin were checked to represent expression levels under different conditions. (D) CaNAC4 relative expression level. (E) CaPR-1 or CaPIN2 relative expression level.
ppj-oa-07-2024-0104f2.jpg
Fig. 3
Phylogenetic tree and multiple amino acid sequence alignment of CaNAC4 and NAC genes from different plant species. The sequences were downloaded from NCBI and TAIR database. (A) MEGA 7.0 was used for phylogenetic tree construction. The CaNAC4 gene is located in the ANAC011 subgroup and close to CaNAC083. (B) The sequence from the same subgroup was aligned with Clustal W. The five conserved subdomains (A-E) in the N-terminal region of the conserved NAC domain are shown by arrows above the sequence.
ppj-oa-07-2024-0104f3.jpg
Fig. 4
Results of phenotypic analysis for salt tolerance in WT and CaNAC4 transgenic plants. The T3 seeds that were surface sterilized were planted on Murashige & Skoog (MS) medium, and then the seedlings were transplanted on a petri dish with MS medium containing different salt concentrations. (A) The phenotypic of the plant after 7 days treatment. (B) The length of the root. (C) The length of shoots. The leaf disks, which were obtained from 4-week-old tobacco plants, were soaked into a solution with different concentrations of NaCl. (D) Phenotypic differences in leaf discs of WT and transgenic plants after treatment with 100 mM and 200 mM for 7 days. (E) Amount of chlorophyll content (mg/cm2) in NaCl treated leaf discs after 7 days. Differences among groups were assessed using ANOVA with Fisher least significant difference tests. Statistical significance was considered at *P < 0.05 and **P < 0.01.
ppj-oa-07-2024-0104f4.jpg
Fig. 5
The phenotype and gene expression analysis after inoculating the necrotrophic pathogen Botrytis cinerea. (A) The phenotypic of necrotic lesions on the plants after 7 days’ inoculation. (B) The lesion size on the plants. (C) The transcription level analysis of defense response genes which could encode antioxidant metabolic enzymes, glutathione S-transferase (GST) and superoxide dismutase (SOD), ascorbate peroxidase (APX), and catalase (CAT) genes. ANOVA was utilized to evaluate variances among groups, supplemented by Fisher’s least significant difference tests. Significance levels were set at **P < 0.01.
ppj-oa-07-2024-0104f5.jpg
Fig. 6
Transgenic plants expressing CaNAC4 react negative against Pseudomonas syringae pv tabaci 11528 (Psta 11528). (A) The symptom at 3rd day after inoculation Psta 11528 between the CaNAC4 overexpression lines and WT tobacco plants. (B) The number of bacterium colony units in WT and transgenic lines. (C) The transcription level analysis of reactive oxygen species scavenging genes after inoculating the host pathogen Psta 11528. APX, ascorbate peroxidase; CAT, catalase; GST, glutathione S-transferase; SOD, superoxide dismutase. Differences among groups were assessed using ANOVA with Fisher least significant difference tests. Statistical significance was considered at *P < 0.05.
ppj-oa-07-2024-0104f6.jpg
Fig. 7
The CaNAC4 overexpression lines suppressed apoptosis regulator Bax-induced cell death. The Bax of concentration OD600 = 0.1 was infiltrated into tobacco plant with 1 ml needleless syringe. The infiltrated leaves were collected and then reverse-transcription polymerase chain reaction was used for gene expression analysis. (A) The phenotypic of hypersensitive response (HR) in the plants caused BAX. (B) the expression level of reactive oxygen species (ROS) scavenging genes in plants. APX, ascorbate peroxidase; CAT, catalase; GST, glutathione S-transferase; SOD, superoxide dismutase.
ppj-oa-07-2024-0104f7.jpg
Table 1
Primers used in this study
Gene Forward (5′-3′) Reverse (5′-3′)
CaNAC4 TACCATGGATGGAGAAGGTTGATTTTGTG TAACTAGTTTAAC GTTTTCTTAAAACTAG
CaPR-1 ACTTGCAATTATGATCCACC ACTCCAGTTACTGCACCATT
CaActin TTGGACTCTGGTGATGGTGTG AACATGGTTGAGCCACCACTG
CaPIN2 CTCGGAATTGTGATACAAGAATTG AAGGTACGTACGGCTGCTTCTTTA
NbAPX1 TCTTGCATGGCACTCTGCTGGTAC CGTTCCTTGTGGCACCTTCCCAAG
NbCAT3 TGCGCATCACAATAATCACCAT TGTCGCGCTTTCCTGTCAA
NbGST1 ATGGCAGAAGTGAAGTTGCTTGG AGCCCAGAAACGAGCTAAAGCTCG
NbSOD3 CGGCAATCAGCGGTGACATAATG CTTTATCCACACCAAGCCACACCC
NbActin TGGTCGTACCACCGGTATTGTGTT TCACTTGCCCATCAGGCTCAT

References

Baek, D., Nam, J., Koo, Y. D., Kim, D. H., Lee, J., Jeong, J. C., Kwak, S.-S., Chung, W. S., Lim, C. O., Bahk, J. D., Hong, J. C., Lee, S. Y., Kawai-Yamada, M., Uchimiya, H. and Yun, D.-J. 2004. Bax-induced cell death of Arabidopsis is meditated through reactive oxygen-dependent and -independent processes. Plant Mol. Biol. 56:15-27.
crossref pmid pdf
Cerda, R., Avelino, J., Gary, C., Tixier, P., Lechevallier, E. and Allinne, C. 2017. Primary and secondary yield losses caused by pests and diseases: assessment and modeling in coffee. PLoS ONE 12:e0169133.
crossref pmid pmc
Cramer, G. R., Urano, K., Delrot, S., Pezzotti, M. and Shinozaki, K. 2011. Effects of abiotic stress on plants: a systems biology perspective. BMC Plant Biol. 11:163.
crossref pmid pmc
Diao, W., Snyder, J. C., Wang, S., Liu, J., Pan, B., Guo, G., Ge, W. and Dawood, M. H. S. A. 2018. Genome-wide analyses of the NAC transcription factor gene family in pepper (Capsicum annuum L.): chromosome location, phylogeny, structure, expression patterns, cis-elements in the promoter, and interaction network. Int. J. Mol Sci. 19:1028.
crossref pmid pmc
Erpen, L., Devi, H. S., Grosser, J. W. and Dutt, M. 2018. Potential use of the DREB/ERF, MYB, NAC and WRKY transcription factors to improve abiotic and biotic stress in transgenic plants. Plant Cell Tissue Organ Cult. 132:1-25.
crossref pdf
Gong, L., Zhang, H., Liu, X., Gan, X., Nie, F., Yang, W., Zhang, L., Chen, Y., Song, Y. and Zhang, H. 2020. Ectopic expression of HaNAC1, an ATAF transcription factor from Haloxylon ammodendron, improves growth and drought tolerance in transgenic Arabidopsis. Plant Physiol. Biochem. 151:535-544.
crossref pmid
Guo, W.-L., Wang, S.-B., Chen, R.-G., Chen, B.-H., Du, X.-H., Yin, Y.-X., Gong, Z.-H. and Zhang, Y.-Y. 2015. Characterization and expression profile of CaNAC2 pepper gene. Front. Plant Sci. 6:755.
crossref pmid pmc
Han, D., Du, M., Zhou, Z., Wang, S., Li, T., Han, J., Xu, T. and Yang, G. 2020. An NAC transcription factor gene from Malus baccata, MbNAC29, increases cold and high salinity tolerance in Arabidopsis. In Vitro Cell. Dev. Biol. Plant 56:588-599.
crossref pdf
He, X., Zhu, L., Xu, L., Guo, W. and Zhang, X. 2016. GhATAF1, a NAC transcription factor, confers abiotic and biotic stress responses by regulating phytohormonal signaling networks. Plant Cell Rep. 35:2167-2179.
crossref pmid pdf
Ju, Y.-L., Min, Z., Yue, X.-F., Zhang, Y.-L., Zhang, J.-X., Zhang, Z.-Q. and Fang, Y.-L. 2020. Overexpression of grapevine VvNAC08 enhances drought tolerance in transgenic Arabidopsis. Plant Physiol. Biochem. 151:214-222.
crossref pmid
Kamble, P. N., Giri, S. P., Mane, R. S. and Tiwana, A. 2015. Estimation of chlorophyll content in young and adult leaves of some selected plants. Univers. J. Environ. Res. Technol. 5:306-310.
Kim, S., Park, M., Yeom, S.-I., Kim, Y.-M., Lee, J. M., Lee, H.-A., Seo, E., Choi, J., Cheong, K., Kim, K.-T., Jung, K., Lee, G.-W., Oh, S.-K., Bae, C., Kim, S.-B., Lee, H.-Y., Kim, S.-Y., Kim, M.-S., Kang, B.-C., Jo, Y. D., Yang, H.-B., Jeong, H.-J., Kang, W.-H., Kwon, J.-K., Shin, C., Lim, J. Y., Park, J. H., Huh, J. H., Kim, J.-S., Kim, B.-D., Cohen, O., Paran, I., Suh, M. C., Lee, S. B., Kim, Y.-K., Shin, Y., Noh, S.-J., Park, J., Seo, Y. S., Kwon, S.-Y., Kim, H. A., Park, J. M., Kim, H.-J., Choi, S.-B., Bosland, P. W., Reeves, G., Jo, S.-H., Lee, B.-W., Cho, H.-T., Choi, H.-S., Lee, M.-S., Yu, Y., Choi, Y. D., Park, B.-S., van Deynze, A., Ashrafi, H., Hill, T., Kim, W. T., Pai, H.-S., Ahn, H. K., Yeam, I., Giovannoni, J. J., Rose, J. K. C., Sørensen, I., Lee, S.-J., Kim, R. W., Choi, I.-Y., Choi, B.-S., Lim, J.-S., Lee, Y.-H. and Choi, D. 2014. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat. Genet. 46:270-278.
crossref pmid pdf
Lee, M.-H., Jeon, H. S., Kim, H. G. and Park, O. K. 2017. An Arabidopsis NAC transcription factor NAC4 promotes pathogen-induced cell death under negative regulation by microRNA164. New Phytol. 214:343-360.
crossref pmid pdf
Liang, K.-H., Wang, A.-B., Yuan, Y.-H., Miao, Y.-H. and Zhang, L.-Y. 2020. Picea wilsonii NAC transcription factor PwNAC30 negatively regulates abiotic stress tolerance in transgenic Arabidopsis. Plant Mol. Biol. Rep. 38:554-571.
crossref pdf
Liu, B., Ouyang, Z., Zhang, Y., Li, X., Hong, Y., Huang, L., Liu, S., Zhang, H., Li, D. and Song, F. 2014. Tomato NAC transcription factor SlSRN1 positively regulates defense response against biotic stress but negatively regulates abiotic stress response. PLoS ONE 9:e102067.
crossref pmid pmc
Lu, M., Sun, Q.-P., Zhang, D.-F., Wang, T.-Y. and Pan, J.-B. 2015. Identification of 7 stress-related NAC transcription factor members in maize (Zea mays L.) and characterization of the expression pattern of these genes. Biochem. Biophys. Res. Commun. 462:144-150.
crossref pmid
Nuruzzaman, M., Manimekalai, R., Sharoni, A. M., Satoh, K., Kondoh, H., Ooka, H. and Kikuchi, S. 2010. Genome-wide analysis of NAC transcription factor family in rice. Gene 465:30-44.
crossref pmid
Nuruzzaman, M., Sharoni, A. M. and Kikuchi, S. 2013. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front. Microbiol. 4:248.
crossref pmid pmc
Oh, S.-K., Baek, K.-H., Park, J. M., Yi, S. Y., Yu, S. H., Kamoun, S. and Choi, D. 2008. Capsicum annuum WRKY protein CaWRKY1 is a negative regulator of pathogen defense. New Phytol. 177:977-989.
crossref pmid pdf
Oh, S.-K., Jang, H. A., Lee, S. S., Cho, H. S., Lee, D.-H., Choi, D. and Kwon, S.-Y. 2014. Cucumber Pti1-L is a cytoplasmic protein kinase involved in defense responses and salt tolerance. J. Plant Physiol. 171:817-822.
crossref pmid
Oh, S.-K., Lee, S., Yu, S. H. and Choi, D. 2005. Expression of a novel NAC domain-containing transcription factor (CaNAC1) is preferentially associated with incompatible interactions between chili pepper and pathogens. Planta 222:876-887.
crossref pmid pdf
Ooka, H., Satoh, K., Doi, K., Nagata, T., Otomo, Y., Murakami, K., Matsubara, K., Osato, N., Kawai, J., Carninci, P., Hayashizaki, Y., Suzuki, K., Kojima, K., Takahara, Y., Yamamoto, K. and Kikuchi, S. 2003. Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res. 10:239-247.
crossref pmid
Peng, X., Zhao, Y., Li, X., Wu, M., Chai, W., Sheng, L., Wang, Y., Dong, Q., Jiang, H. and Cheng, B. 2015. Genomewide identification, classification and analysis of NAC type gene family in maize. J. Genet. 94:377-390.
crossref pmid pdf
Puranik, S., Sahu, P. P., Srivastava, P. S. and Prasad, M. 2012. NAC proteins: regulation and role in stress tolerance. Trends Plant Sci. 17:369-381.
crossref pmid
Qin, C., Yu, C., Shen, Y., Fang, X., Chen, L., Min, J., Cheng, J., Zhao, S., Xu, M., Luo, Y., Yang, Y., Wu, Z., Mao, L., Wu, H., Ling-Hu, C., Zhou, H., Lin, H., González-Morales, S., Trejo-Saavedra, D. L., Tian, H., Tang, X., Zhao, M., Huang, Z., Zhou, A., Yao, X., Cui, J., Li, W., Chen, Z., Feng, Y., Niu, Y., Bi, S., Yang, X., Li, W., Cai, H., Luo, X., Montes-Hernández, S., Leyva-González, M. A., Xiong, Z., He, X., Bai, L., Tan, S., Tang, X., Liu, D., Liu, J., Zhang, S., Chen, M., Zhang, L., Zhang, L., Zhang, Y., Liao, W., Zhang, Y., Wang, M., Lv, X., Wen, B., Liu, H., Luan, H., Zhang, Y., Yang, S., Wang, X., Xu, J., Li, X., Li, S., Wang, J., Palloix, A., Bosland, P. W., Li, Y., Krogh, A., Rivera-Bustamante, R. F., Herrera-Estrella, L., Yin, Y., Yu, J., Hu, K. and Zhang, Z. 2014. Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization. Proc. Natl. Acad. Sci. U. S. A. 111:5135-5140.
crossref pmid pmc
Rushton, P. J., Bokowiec, M. T., Han, S., Zhang, H., Brannock, J. F., Chen, X., Laudeman, T. W. and Timko, M. P. 2008. Tobacco transcription factors: novel insights into transcriptional regulation in the Solanaceae. Plant Physiol. 147:280-295.
crossref pmid pmc pdf
Shen, J., Lv, B., Luo, L., He, J., Mao, C., Xi, D. and Ming, F. 2017. The NAC-type transcription factor OsNAC2 regulates ABA-dependent genes and abiotic stress tolerance in rice. Sci. Rep. 7:40641.
crossref pmid pmc pdf
Strange, R. N. and Scott, P. R. 2005. Plant disease: a threat to global food security. Annu. Rev. Phytopathol. 43:83-116.
crossref pmid
Su, H., Zhang, S., Yin, Y., Zhu, D. and Han, L. 2015. Genome-wide analysis of NAM-ATAF1, 2-CUC2 transcription factor family in Solanum lycopersicum. J. Plant Biochem. Biotechnol. 24:176-183.
crossref pdf
Tran, L.-S. P., Nakashima, K., Sakuma, Y., Simpson, S. D., Fujita, Y., Maruyama, K., Fujita, M., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. 2004. Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16:2481-2498.
pmid pmc
Tweneboah, S. and Oh, S.-K. 2017. Biological roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in solanaceous crops. J. Plant Biotechnol. 44:1-11.
crossref
Tyagi, H., Jha, S., Sharma, M., Giri, J. and Tyagi, A. K. 2014. Rice SAPs are responsive to multiple biotic stresses and overexpression of OsSAP1, an A20/AN1 zinc-finger protein, enhances the basal resistance against pathogen infection in tobacco. Plant Sci. 225:68-76.
crossref pmid
Wang, G., Zhang, S., Ma, X., Wang, Y., Kong, F. and Meng, Q. 2016. A stress-associated NAC transcription factor (SlNAC35) from tomato plays a positive role in biotic and abiotic stresses. Physiol. Plant 158:45-64.
pmid
Wang, N., Zheng, Y., Xin, H., Fang, L. and Li, S. 2013. Comprehensive analysis of NAC domain transcription factor gene family in Vitis vinifera. Plant Cell Rep. 32:61-75.
crossref pmid pdf
Wang, X., Basnayake, B. M. V. S., Zhang, H., Li, G., Li, W., Virk, N., Mengiste, T. and Song, F. 2009. The Arabidopsis ATAF1, a NAC transcription factor, is a negative regulator of defense responses against necrotrophic fungal and bacterial pathogens. Mol. Plant-Microbe Interact. 22:1227-1238.
crossref pmid
Wang, Y., Cao, S., Guan, C., Kong, X., Wang, Y., Cui, Y., Liu, B., Zhou, Y. and Zhang, Y. 2020. Overexpressing the NAC transcription factor LpNAC13 from Lilium pumilum in tobacco negatively regulates the drought response and positively regulates the salt response. Plant Physiol. Biochem. 149:96-110.
crossref pmid
Yan, J., Tong, T., Li, X., Chen, Q., Dai, M., Niu, F., Yang, M., Deyholos, M. K., Yang, B. and Jiang, Y.-Q. 2018. A novel NAC-type transcription factor, NAC87, from oilseed rape modulates reactive oxygen species accumulation and cell death. Plant Cell Physiol. 59:290-303.
crossref pmid
Yoon, Y., Seo, D. H., Shin, H., Kim, H. J., Kim, C. M. and Jang, G. 2020. The role of stress-responsive transcription factors in modulating abiotic stress tolerance in plants. Agronomy 10:788.
crossref
Zhang, H., Ma, F., Wang, X., Liu, S., Saeed, U. H., Hou, X., Zhang, Y., Luo, D., Meng, Y., Zhang, W., Abid, K. and Chen, R. 2020. Molecular and functional characterization of CaNAC035, an NAC transcription factor from pepper (Capsicum annuum L.). Front. Plant Sci. 11:14.
crossref pmid pmc
Zhao, Y., Chen, J., Tao, X., Zheng, X. and Mao, L. 2014. The possible role of BAX and BI-1 genes in chilling-induced cell death in cucumber fruit. Acta Physiol. Plant 36:1345-1351.
crossref pdf
TOOLS
METRICS Graph View
  • 7 Web of Science
  • 7 Crossref
  •  0 Scopus
  • 3,249 View
  • 167 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next