Plants are commonly exposed to a wide variety of environmental stressors that affect their productivity. A previous study has reported that in 2007, only 3.5% of the global land area was unaffected by environmental stresses (Cramer et al., 2011). Environmental stress can be grouped into two types: biotic and abiotic stress. Biotic stresses—including fungi, viruses, bacteria, oomycetes, nematodes, and parasitic plants—cause 26-38% of global food yield losses (Cerda et al., 2017; Strange and Scott, 2005). Abiotic stresses include salt stress, drought, and low and high temperatures, which are the main causes of agricultural productivity loss globally.
Plant-specific transcription factors (TFs) play a vital role in regulating plant development and the responses of plants to biotic and abiotic stresses (Lee et al., 2017; Yoon et al., 2020). Currently, the most widely studied TFs in plants include those in the NAC, AP2/EREBP, MYB, and WRKY families (Erpen et al., 2018; Nuruzzaman et al., 2013). The NAC gene family is one of the most important TF gene families in plants. The name NAC was initially obtained from the names of three proteins containing similar DNA-binding domains: the petunia NAM (no apical meristem), ATAF1 & 2 (Arabidopsis thaliana transcriptional activation factor), and CUC2 (cup-shaped cotyledon) (Han et al., 2020; Puranik et al., 2012; Tweneboah and Oh, 2017). With the development of genome sequencing technology and bioinformatics, more than 100 NAC TFs have been identified in various plants. For example, 106 NAC genes have been identified in Capsicum annuum (Kim et al., 2014), 117 in A. thaliana (Nuruzzaman et al., 2010), 74 in Vitis vinifera (Wang et al., 2013), 148 in Zea mays (Peng et al., 2015), and 104 in Solanum (Su et al., 2015). Moreover, 151 NAC TFs have been identified in Oryza sativa (Nuruzzaman et al., 2010), along with 152 in Nicotiana tabacum (Rushton et al., 2008).
A typical NAC protein usually contains a highly conserved N-terminal NAC domain and a diversified C-terminal domain (Nuruzzaman et al., 2013). The NAC domain of NAC TFs contains nearly 150-160 amino acids, and can be further separated into five subdomains (A-E) (Ooka et al., 2003). The C-terminus typically serves as a potential transcriptional regulator that can either increase or decrease transcription (Puranik et al., 2012).
Published literature indicates that several NAC genes are involved in regulating pathogen resistance and abiotic tolerance in plants. For example, in transgenic tobacco lines that overexpress LpNAC13 (a Lilium pumilum NAC TF), the TF negatively regulates drought tolerance and positively regulates the response to salt stress (Wang et al., 2020). In addition, PwNAC30—an NAC TF found in Picea wilsonii—reduces plant tolerance to drought and salt stress (Liang et al., 2020). Overexpression of the grapevine gene VvNAC08 in Arabidopsis results in markedly enhanced drought tolerance (Ju et al., 2020). HaNAC1 (an NAC TF from Haloxylon ammodendron) enhances tolerance to drought stress and upregulates the stress-response genes RD22, ERD11, P5CS1, NCED1, RD29a, and LEA3 (Gong et al., 2020). Liu et al. (2014) reported that treatment with the hormones salicylic acid (SA), jasmonate (JA), and 1-aminocyclopropanecarboxylic acid (ACC) induced the expression of the tomato TF, SISRN1. Using a virus-induced gene-silencing technique, the authors demonstrated that SISRN1 plays a positive role in plant defense against Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 (Liu et al., 2014). The TF GhATAF1 is isolated from cotton, and is induced by the plant hormones abscisic acid (ABA), JA, and methyl jasmonate (MeJA), as well as by abiotic stresses such as low temperatures and salt. GhATAF1-overexpressing plants upregulate stress-responsive genes (AVP1, RD22, DREB2A, LEA3, and LEA6) and JA- and SA-mediated signaling pathways, which provides them with enhanced salt tolerance and defenses against pathogens such as B. cinerea and Verticillium dahlia (He et al., 2016).
Kim et al. (2014) analyzed the whole-genome sequence of C. annuum and reported 106 NAC (CaNAC) TFs in the chili pepper genome, most of which are involved in pathogen responses and plant development processes. The CaNAC1 TF was first identified and functionally analyzed in 2005, and was reported to enhance plant defense responses against non-host pathogens (Oh et al., 2005). The CaNAC2 gene was found to be involved in enhancing tolerance to low temperatures and salt stress (Guo et al., 2015). Although the analysis of the whole-genome sequence in this species indicated the existence of hundreds of NAC TFs, few studies have examined their functions. Therefore, more studies are required in this area.
In this study, we successfully identified and characterized CaNAC4, a novel NAC family gene in C. annuum. The primary purpose of this study was to examine the functional roles of CaNAC4. To understand the functions of CaNAC4 under biotic and abiotic stresses, the phenotypes of CaNAC4-overexpressing Nicotiana benthamiana lines were compared with those of wild-type (WT) plants after treatment with biotic and abiotic stresses, including salt stress and infection with B. cinerea and Pseudomonas syringae pv. tabaci 11528 (Psta 11528). In addition, reverse-transcription polymerase chain reaction (RT-PCR) was performed to compare the expression levels of several defense response-related genes that may be regulated by CaNAC4.
Materials and Methods
Plant materials and growth conditions
The seeds of chili pepper (Capsicum annuum cv. Jindaegeon) were purchased from Asia Seed Co., Ltd. (Seoul, Korea), and N. benthamiana seeds were obtained from the Molecular Plant Fungal Pathology Laboratory, Chungnam National University. The seeds were planted in a greenhouse under a 16 h/8 h day/night photoperiod with 25°C average temperature and 65% average relative humidity. We used 5-6-week-old plants in this study (Wang et al., 2016).
Bacterial cultures and inoculation
The bacterial pathogens Xanthomonas axonopodis pv. vesicatoria race 3 (the causative agent of bacterial spots in pepper) and X. axonopodis pv. glycines 8ra (the soybean pustule pathogen) (Oh et al., 2005) were provided by the Molecular Plant Fungal Pathology Laboratory, Chungnam National University. The pathogens were cultured on solid yeast extract pectin (YEP; yeast extract, 10 g/l; peptone, 10 g/l; sodium chloride [NaCl], 5 g/l; agar, 15 g/l) medium by streaking and incubated at 28°C in dark conditions for 2 days. Following this, a single bacterial colony was inoculated into 25 ml YEP liquid medium using a sterile pipette tip and incubated at 28°C and 180 rpm for 30 h. The suspensions were then centrifuged at 3,000 rpm for 20 min at 25°C. The supernatant was removed and the residue was resuspended in 10 mM MgCl2 buffer until OD600 = 0.1. Pathogens were inoculated into chili pepper leaves as previously described (Oh et al., 2008). Pressure infiltration was performed on the underside of tobacco leaves using a 1,000 μl needleless syringe. Plants inoculated with 10 mM MgCl2 buffer were used as controls, and the treated plants were grown in a greenhouse. Samples were collected in 2 ml e-tubes at time intervals of 0, 1.5, 3, 6, 12, 24, 48, and 72 h after inoculation. The samples were directly snap-frozen in liquid nitrogen and stored at −70°C for further analysis.
cDNA synthesis and gene expression analysis
Total RNA was isolated from treated leaves using TRIzol reagent (Molecular Research Center Inc., Cincinnati, OH, USA). LeGene cDNA Synthesis Master Mix (LeGene Biosciences Inc., San Diego, CA, USA) was used for cDNA synthesis. Following the cDNA was used for standard PCR. The Actin gene (the housekeeping gene) was used as a standard to quantify the expression levels of each target gene. Finally, the PCR products were examined using 1.0% agarose gel electrophoresis (Rushton et al., 2008). All the primers used in this study are shown in Table 1. The densitometry data for band intensities was generated by analyzing the gel images on the Image J program version 1.53e (National Institutes of Health, Bethesda, MD, USA; http://rsb.info.nih.gov/ij/).
Chemical treatment and wounding
For the chemical treatment, SA (247588, Sigma-Aldrich, St. Louis, MO, USA) was dissolved in ddH2O at a concentration of 10 mM. ABA (100 μM, A1046, Sigma-Aldrich) was prepared. The chemical hormones were sprayed on the surface of the chili pepper plants. For wounding treatment, the chili pepper leaves were wounded by using the sterilized needleless syringe. The treated plants were harvested at different time points (0-24 h) after treatment. The samples were immediately frozen in liquid nitrogen and stored at −70°C for further study (Tyagi et al., 2014).
Cloning and sequence analysis of the CaNAC4 gene
Total RNA was isolated from the chili pepper plant, and reverse transcription was performed using a cDNA synthesis kit as described previously. The primers CaNAC4-F (TACCATGGATGGAGAAGGTTGATTTTGTG) and CaNAC4-R (TAACTAGTTTAAC GTTTTCTTAAAACTAG) were used to amplify the open reading frame (ORF) sequence of CaNAC4. Subsequently, the PCR amplification products were cloned into the pMD20-T vector using a TA cloning kit (Takara Bio Inc., Shiga, Japan). CaNAC4 was sequenced by Macrogen, Inc. (Seoul, Korea).
Phylogenetic analysis of the CaNAC4 gene
The FASTA sequence of CaNAC4 was used as a template for BLAST, and similar sequences were downloaded from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) and Arabidopsis Information Resource (http://www.arabidopsis.org/) websites. A phylogenetic tree was created using MEGA 7.0 (Yan et al., 2018). CLUSTAL W was used to perform multiple sequence alignment of the NAC genes, and phylogenetic analysis was performed using the neighbor-joining method and 1,000 bootstrap replicates.
Agrobacterium-mediated transformation of N. benthamiana
The CaNAC4-transgenic N. benthamiana line was developed as described by Wang et al. (2016) with some modifications. To construct the expression vector, the ORF of CaNAC4 was PCR-amplified using specific primers with restriction sites for XbaI and KpnI. The pCAMBIA2300 vector and the target fragments were double-digested with the XbaI and KpnI restriction enzymes, and the target fragment was ligated into the pCAMBIA2300 vector to construct the pCAMBIA2300-CaNAC4 super-expression vector. The leaf discs of the N. benthamiana plant were infected with GV3101 Agrobacterium suspension carrying pCAMBIA2300-CaNAC4 recombinant vector. The shoots were produced on the shoot-inducing medium, and the rooted plants were finally acclimatized in plotting soil. Seeds of the transformed plants were sterilized as described previously and then planted in Murashige & Skoog (MS) medium containing kanamycin (50 mg/l). the transformed plants were selected as the T1 generation plants.
Salt stress treatment of CaNAC4-transgenic plants
To determine the stable inheritance and role of the CaNAC4 gene under salt stress, T3 seeds were cultured on MS medium containing kanamycin (50 mg/l). After 7 days, budding seedlings were transplanted to MS medium containing 0, 100, and 200 mM NaCl. The roots and shoots of the WT and CaNAC4-transgenic tobacco lines were measured.
Healthy leaf discs were acquired from 4-week-old leaves that had been soaked in ddH2O for 2 h and then floated in a NaCl solution (100 and 200 mM) for 3 days. The traditional alcohol extraction method was used to extract the chlorophyll content of leaves (Kamble et al., 2015).
Biotic stress treatments of CaNAC4-transgenic plants
Botrytis cinerea
B. cinerea was cultured on V8 medium (V8 juice, 200 ml; agar, 15 g; CaCO3, 2.5 g; ddH2O, 800 ml) and incubated at 25°C for 7 days. The spore suspension was collected using sterile water and gauze, and adjust the concentration of the suspension to approximately 1 × 106 spores/ml. Four-week-old leaves were harvested from the CaNAC4-transgenic and WT plants, surface sterilized by soaking in 1% NaOCl for 2 min, and then washed in ddH2O three times. Following this, 10 μl of the spore solution was dropped on the detached leaves using a pipette. Finally, the treated leaves were stored in a sealed plastic box to maintain humidity. The symptoms of B. cinerea infection were checked daily and the size of the disease symptoms was measured simultaneously (Oh et al., 2014).
Pseudomonas syringae pv. tabaci 11528
We used 4-week-old WT and CaNAC4-transgenic lines and analyzed their pathogen tolerance against Psta 11528. Psta 11528 was cultured at liquid YEP medium, incubated at 180 rpm at 30°C for 2 days, and centrifuged at 12,000 rpm for 10 min. Next, the supernatant was discarded, the pellet was resuspended in 10 mM MgCl2 buffer, and the OD600 was adjusted to 0.1. The suspension of the bacterial solution was pressure-infiltrated into the leaves of WT and CaNAC4-transgenic plants using a 1,000 μl needleless syringe. The bacterial suspension was also infiltrated into tobacco plants placed under greenhouse conditions. Disease symptoms were checked and recorded with a camera after 3 days.
To estimate bacterial growth in the WT and CaNAC4-transgenic plants, the infiltrated leaves were harvested, sterilized using 70% ethanol for 1 min, and washed in ddH2O three times. The leaf discs were disinfected, ground in 10 mM MgCl2 using a sterile pestle, and centrifuged at 3,500 rpm for 5 min. Following this, 10 μl of the supernatant was transferred into a new tube and diluted 10 times using sterile water. The diluted bacterial suspension (2 μl) was spread on YEP medium containing the appropriate antibiotics, and the culture was incubated at 30°C for 3 days. The bacterial colony-forming units (cfu) were counted, and the experiment was repeated at least thrice (Tyagi et al., 2014; Wang et al., 2016).
The apoptosis regulator BAX
BAX (Bcl-2-associated X protein) is a death-promoting member of the Bcl-2 gene family, and can trigger cell death when expressed in plants (Zhao et al., 2014). The BAX protein was acquired from the Molecular Plant Fungal Pathology Laboratory at Chungnam National University and transformed into Agrobacterium. Agroinfiltration was performed as described in Psta 11528, and a needleless syringe (1,000 l) was used to inject the solution into the leaves of 4-week-old tobacco plants. The BAX-infiltrated plants were kept in a greenhouse for 3 days under the conditions described previously, and the symptoms of cell death were recorded. The BAX-infiltrated leaves were collected into a 1.5 ml tube and kept −70°C for further gene expression analysis.
Results
Expression of CaNAC4 in chili pepper following pathogen inoculation
To investigate the possible roles of CaNAC4 in resistance against pathogens, we investigated the expression pattern of CaNAC4 after infiltrating chili plants with the non-host incompatible pathogen X. axonopodis pv. glycines 8ra and the compatible pathogen X. axonopodis pv. vesicatoria race 3. The control plants were infiltrated with buffer MgCl2. For gene expression analysis, the housekeeping gene actin was used as a control. The pathogenesis-related protein 1 (PR-1) gene was used as a positive control because it is expressed at high levels during infection by various pathogens. The results showed that when chili pepper plants were infiltrated with buffer MgCl2, there were no significant changes in the expression level of CaNAC4 in chili pepper plants (Fig. 1A and D). After inoculation with the compatible pathogen X. axonopodis pv. vesicatoria race 3, the transcription levels of CaNAC4 increased from 1.5 h after inoculation (hai), peaked at 3 hai, and later the expression level decreased (Fig. 1B and D). After inoculation with the incompatible pathogen X. axonopodis pv. glycines 8ra, the expression level of CaNAC4 increased at 1.5 hai, and peaked at 72 hai (Fig. 1C and D). These results indicated that CaNAC4 expression is induced by both types of pathogens, suggesting that CaNAC4 plays a role in the response to both compatible and incompatible pathogens.
Expression of CaNAC4 after chemical treatment and wounding in chili pepper
Previous studies have indicated that during biotic stress, most NAC TFs elicit plant defense responses through the SA or JA signaling pathways and activate stress-responsive genes to impact plant stress tolerance through the ABA or JA signaling pathways. The transcriptional expression of the CaNAC4 gene was investigated after treating chili pepper plants with SA and ABA. The results showed that when treated with 5 mM SA, CaNAC4 gene expression changed, and peaked 12 h after treatment (Fig. 2A and D). The transcription level of CaNAC4 increased since 0.5 h after treatment with 100 μl ABA, and peaked at 9 h (Fig. 2B and D). After wounding the chili leaves, CaNAC4 expression levels gradually increased after 0.5 h treatment and peaked at 12 hai (Fig. 2C and D). These results indicate that the expression of the CaNAC4 gene was activated by the phytohormones ABA and SA and by wounding.
Phylogenetic analysis of CaNAC4
NAC family genes have been comprehensively studied in O. sativa and the model plant Arabidopsis thaliana (ANACs). NAC family proteins can be classified into two groups and 18 subgroups (Ooka et al., 2003). We used MEGA 7.0 to perform phylogenetic analysis using the nucleic acid sequence of CaNAC4 and other known sequences from O. sativa and A. thaliana. The results showed that CaNAC4 clustered with ANAC011 and was highly homologous to CaNAC083 (Fig. 3A).
The protein sequences of CaNAC4 were transcribed based on the nuclear sequence, and the sequences of ANAC071, ANAC096, ANAC011, ANAC045, ANAC086, ANAC028, ANAC057, ANAC020, and CaNAC083 were downloaded from NCBI. These were aligned using Clustal W, and clustered in the same subgroup as ANAC011. The alignment results demonstrated that the N-terminus had a conserved NAC domain and could be further separated into five subdomains (A, B, C, D, and E) (Fig. 3B). Furthermore, subdomains A, C, and D were found to be conserved, whereas subdomains B and E were relatively divergent.
CaNAC4-transgenic lines show enhanced salt tolerance
To evaluate the function of CaNAC4 in tolerance to salinity stress, we used Agrobacterium-mediated transformation to overexpress the CaNAC4 gene in tobacco. Five transgenic lines were generated, of which lines 2 and line 3 showed stable expression in T3 seeds and were used for subsequent experiments. One-week-old tobacco plants were transplanted to MS medium containing different concentrations of NaCl. After 7 days, no differences were observed between the WT and CaNAC4-transgenic lines when plants were grown on MS medium without salt stress (Fig. 4A-C). When grown on MS medium containing NaCl (100 and 200 mM), WT tobacco plants were severely repressed, especially at 200 mM. The CaNAC4-transgenic lines showed tolerance to salinity stress. The roots and shoots of CaNAC4-transgenic lines were approximately twice as long as those of the WT plants (Fig. 4A-C).
Leaf discs from 4-week-old CaNAC4-overexpressing and WT tobacco plants were soaked in NaCl solutions (100 and 200 mM) for 7 days. In the leaf discs from WT plant, the color started to recede from green to white, especially in those soaked in 200 mM NaCl. However, the leaf discs from CaNAC4-transgenic lines did not show any significant change in color (Fig. 4D). We investigated the chlorophyll content of leaf discs after salt treatment. The salt stress-induced loss of chlorophyll content was lower in CaNAC4-transgenic lines than in WT plants (Fig. 4E). Taken together, these results indicate that the CaNAC4 gene enhances tolerance to salt stress in transgenic tobacco plants.
CaNAC4-transgenic N. benthamiana plants show higher levels of B. cinerea infection
The necrotrophic pathogen, B. cinerea, was used to investigate the role of CaNAC4 in response to pathogen stress. We found that the disease symptoms were milder in WT plants than in the CaNAC4-overexpressing lines. The disease caused by B. cinerea gradually increased in severity, and symptoms became clearer in CaNAC4-transgenic lines. Accordingly, the average diameters of necrotic lesions were recorded at approximately 0.50 cm in WT plants and at approximately 0.65-0.75 cm in CaNAC4-transgenic lines (Fig. 5A and B). These results illustrate that CaNAC4 may be a negative regulator of plant defense responses against the necrotrophic B. cinerea.
To examine how CaNAC4 reduces the defense responses to necrotrophic fungi, we measured the expression levels of defense-related genes in CaNAC4-transgenic lines using RT-PCR. Previous research has shown that in plant cells, genes encoding antioxidant metabolic enzymes—such as ascorbate glutathione peroxidase (GPX), peroxidase (APX), glutathione S-transferase (GST), catalase (CAT), and superoxide dismutase (SOD)—are involved in defense responses and the scavenging of reactive oxygen species (ROS). In the WT N. benthamiana plant, we found that the transcript levels of NbCAT3, NbGST1, and NbSOD3 were induced after inoculation with B. cinerea. And after infected the B. cinere, there genes expression level was lower in the CaNAC4-transgenic lines compared with the WT. But the expression levels of NbAPX1 did not change in CaNAC4-transgenic or WT lines (Fig. 5C).
CaNAC4-transgenic plants react negatively to Psta 11528 infection
Psta 11528 causes wild-fire disease in tobacco plants. To examine the role of CaNAC4 against Psta 11528 infection in tobacco plants, we infiltrated a Psta 11528 suspension into the WT and CaNAC4-overexpression lines and monitored the disease symptoms. After 3 days, the symptoms of Psta 11528 infection were distinctive in the CaNAC4-transgenic lines. In contrast, the expansion of the disease was delayed in the WT plants (Fig. 6A). The infiltrated leaves were incubated on YEP medium containing rifampicin for 30 h at 30°C, and the cfus on these leaves were counted. The average number of cfus was significantly higher in CaNAC4-transgenic lines than in WT plants (Fig. 6B). Moreover, we examined the expression levels of defense-related genes in the leaves of CaNAC4-transgenic and WT tobacco plants inoculated with Psta 11528. In the WT N. benthamiana plant, we observed that the transcript levels of NbCAT3, NbGST1, and NbSOD3 were elevated following inoculation with Psta 11528. Moreover, post-infection with Psta 11528, the expression levels of these genes were diminished in the CaNAC4-transgenic lines compared to the WT, although the expression levels of NbAPX1 did not change significantly (Fig. 6C).
CaNAC4-transgenic plants inhibit BAX-induced cell death
BAX is a cell death-promoting protein in mammalian cells that can also trigger cell death when expressed in plants (Baek et al., 2004). In this study, we infiltrated CaNAC4-transgenic and WT tobacco plants with BAX at a concentration of OD600 = 0.1. After 3 days of infiltration, the symptoms of cell death were checked. The results showed that cell death symptoms were suppressed in CaNAC4-transgenic plants (Fig. 7A).
The RT-PCR results indicated that the expression level of NbGST which is involved in defense responses. However, the transcript levels of NbAPX1, NbSOD3 were not significantly different in the CaNAC4-transgenic and WT lines (Fig. 7B).
Discussion
Plant-specific NAC TFs are among the largest families of TFs in the plant kingdom and play a crucial role in biotic stress response and abiotic stress tolerance (Han et al., 2020; Liang et al., 2020; Wang et al., 2020). The functional analysis of NAC genes has largely been conducted in other plant species, such as rice, tomato, and maize (Lu et al., 2015; Shen et al., 2017; Wang et al., 2016). However, only a few NAC genes and their functions have been studied in detail in C. annuum (Guo et al., 2015; Kim et al., 2014; Oh et al., 2005; Zhang et al., 2020). Extensive research on gene functions is required for the collection of adequate information on breeding strategies. In the current study, we identified CaNAC4, which is a novel NAC TF in C. annuum.
Recently, whole-genome analyses of C. annuum have indicated the existence of more than 100 NAC genes in this species. These genes can be classified into three main groups (Groups I, II, and III), which can be further divided into 14 subgroups in Group I, 4 subgroups in Group II, and 1 Solanaceae-specific NAC in Group III (Diao et al., 2018; Qin et al., 2014). Phylogenetic analysis revealed that CaNAC4 clustered in Group I within the ANAC011 subgroup (Fig. 3A). Protein sequence alignment revealed that there were only two amino acids that differed between CaNAC4 and CaNAC083, which shows that CaNAC4 has a conserved N-terminal NAC domain. Furthermore, the conserved N-terminal region contained five subdomains (A, B, C, D, and E). Further analysis indicated that subdomains A, C, and D were conserved, whereas subdomains B and E were relatively divergent (Fig. 3B). These results demonstrated that CaNAC4 is a C. annuum TF (CaNAC).
In C. annuum, the expression of CaNAC1 can be induced through treatment with phytohormones (SA, ethylene, and JA) and inoculation with pathogens (Oh et al., 2005). CaNAC2 is involved in plant responses to salt and cold stresses, and CaNAC2 expression is induced by SA and ABA (Guo et al., 2015). Transcription of CaNAC035 is induced by gibberellic acid, MeJA, SA, and ABA, which play positive roles in abiotic stresses (Zhang et al., 2020). In this study, the RT-PCR results demonstrated that the expression levels of CaNAC4 were elevated by ABA, SA, wounding treatment, and inoculation with pathogens (X. axonopodis pv. vesicatoria race 3 and X. axonopodis pv. glycines 8ra). Accordingly, we predicted that CaNAC4 is involved in biotic and abiotic stress responses in these plants.
To evaluate the functions of CaNAC4, we transferred the CaNAC4 gene into N. benthamiana. the results suggest that CaNAC4 plays a positive role in tobacco plants under salt stress (Fig. 4). Previous studies have reported that NAC TFs generally regulate abiotic stress through ABA-dependent and/or ABA-independent signaling pathways (Puranik et al., 2012; Shen et al., 2017; Tran et al., 2004). In this study, the transcription levels of CaNAC4 were increased by treatment with ABA and SA. Therefore, we speculate that the CaNAC4 gene may be involved in response to biotic stress, likely through the ABA-dependent and/or SA-dependent pathways; however, this still needs to be confirmed in future studies.
To elucidate the role of CaNAC4 in biotic stress, we inoculated tobacco leaves with the necrotrophic fungus B. cinerea and the bacterium Psta 11528. Wang et al. (2009) demonstrated that ATAF1, a drought-inducible gene in Arabidopsis belonging to the NAC family, acts as a negative regulator of plant defense responses to B. cinerea and Pst DC3000. Furthermore, Liu et al. (2014) found that the Solanum lycopersicum Stress-related NAC1 (SISRN1) TF exacerbates disease severity caused by Pst DC3000 and B. cinerea. In the present study, we found that the CaNAC4-overexpressing tobacco lines showed increased symptoms of the disease caused by B. cinerea (Fig. 5A and B). RT-PCR demonstrated that the expression levels of NbGST1, NbSOD3, and NbCAT3 were induced after inoculation with B. cinerea compared with the non-infected plant, but the level of induced was inhibited in the transgenic lines (Fig. 5C). The number of Psta 11528 in the leaves of CaNAC4-overexpressing lines also increased following incubation with the pathogen (Fig. 6A and B). Moreover, RT-PCR indicated that the expression levels of NbGST1, NbSOD3, and NbCAT3 were increased after infection with Psta 11528 compared with the non-infected WT N. benthamiana plant. However, these gene expression levels were lower in the CaNAC4-overexpressing lines (Fig. 6C). These results suggest that CaNAC4 plays a negative role in responses to biotic stress. The GST, SOD, CAT, and GPX genes encode antioxidant metabolic enzymes and play key roles in scavenging ROS to maintain ROS balance in plants (Han et al., 2020; Tyagi et al., 2014). Based on our results, we infer that CaNAC4 reduces the scavenging capability of plants by downregulating scavenging enzymes such as GST, SOD, and CAT. As a result, the high level of production of ROS increases the disease susceptibility of plants.


PDF Links
PubReader
ePub Link
Full text via DOI
Full text via PMC
Download Citation
Print






