Plant Pathol J > Volume 40(6); 2024 > Article
Kim, Yoon, Kang, Kim, and Boo: Development of a Multiplex PCR to Simultaneously Detect Four Problematic Pathogens in Cymbidium kanran

Abstract

Colletotrichum gloeosporioides (Cg), Pestalotiopsis sp. (Ps), Fusarium oxysporum (Fo), and Fusarium proliferatum (Fp) are pathogens that cause various diseases of Cymbidium kanran. Species identification based on the morphological characteristics of pathogen-infected orchids is very complex and difficult; therefore, specific and reliable diagnostic methods are needed. Here, we developed a multiplex polymerase chain reaction (PCR) assay for simultaneous detection of Cg, Ps, Fo, and Fp. Four pairs of pathogen-specific primers were designed based on the internal transcribed spacer sequences of each pathogen, generating fragments of 480, 407, 321, and 279 bp, respectively. The multiplex PCR assay using these four pairs of mixed primers effectively detected the four pathogens simultaneously, with a sensitivity of 0.1 ng genomic DNA/pathogen. Application of the optimized multiplex PCR assay to symptomatic C. kanran leaf samples effectively detected single or multiple pathogens. These results indicate that the multiplex PCR developed in this study is not only a rapid and reliable method for detecting four problematic pathogens in C. kanran, but also serves as a very useful tool for early diagnosis.

Cymbidium, a genus belonging to the Orchidaceae family, is distributed widely throughout Asia (Du Puy and Cribb, 1988). About 44 Cymbidium cultivars bred to yield improved horticultural characteristics have become commercially available, making it a popular horticultural plant on the global flower market (Arditti and Pridgeon, 1997). Among them, Cymbidium kanran, which blooms fragrant flowers with diverse shapes, colors, and patterns in winter, is an endangered species. C. kanran is distributed mainly in Japan, Taiwan, China, and Korea (Du Puy and Cribb, 1988). In Korea, Jeju Island is the sole location in which C. kanran is preserved. To protect the orchid species from the detrimental impact of rapid environmental changes and development, the natural habitat in Sanghyo-dong, Jeju, was designated as Korean Natural Monument No. 432 in 2002 (Cultural Heritage Administration of Korea, http://www.cha.go.kr).
The pathogens that are most problematic in C. kanran habitats are Colletotrichum gloeosporioides (Cg), Pestalotiopsis sp. (Ps), Fusarium oxysporum (Fo), and F. proliferatum (Fp) (Jeju Province World Natural Heritage Center, 2020). Cg is one of the most common Colletotrichum fungal plant pathogens, exhibiting a diverse range of symptoms depending on the infected host species and tissue type. Cg, first reported as a causal agent of anthracnose in C. kanran in Korea, forms dark brown to black concentric rings at the tips of leaves (Park and Seo, 2013). Later, Colletotrichum cymbidiicola was identified as a new species causing anthracnose on Cymbidium orchids in Korea (Park et al., 2020); however, a recent report identified Cg as the predominant pathogen causing anthracnose in C. kanran habitats on Jeju Island (Jeju Province World Natural Heritage Center, 2020).
Ps is a plant pathogen that infects a wide range of hosts, often under stress conditions (Maharachchikumbura et al., 2014). Typically, they are associated with leaf spot diseases, fruit rot, and dieback in various plants. In C. kanran, Ps causes leaf scorch, which begins as small, light brown lesions at the tips of the leaves. These lesions expand gradually, resulting in a characteristic grayish-brown pattern at the edge of the lesion (Jeju Province World Natural Heritage Center, 2020).
The genus Fusarium comprises a diverse group of soil-borne fungi known for their ability to infect a wide range of plant hosts. The fungi are distributed globally, and are particularly notorious for causing various plant diseases, which can lead to significant agricultural and horticultural losses (Michielse and Rep, 2009). Fo is responsible for causing stem rot in C. kanran, a condition that prevents emergence of new leaves and eventually leads to wilting (Lee et al., 2002). In addition, Fp causes spot disease in C. kanran, characterized by formation of small, round spots scattered across the leaves (Jeju Province World Natural Heritage Center, 2020).
Rapid and accurate detection of plant diseases at an early stage is important to minimize crop losses and establish appropriate control strategies. A traditional method of detecting pathogens is tissue isolation and culture, which requires taxonomic expertise and is time-consuming (Rahman et al., 2017). Moreover, accurate diagnosis based on morphological identification is difficult because similar symptoms may be caused by different pathogens, or multiple pathogens may infect the plant simultaneously. Molecular methods such as polymerase chain reaction (PCR) serve as valuable alternatives to conventional approaches (Han et al., 2015; Jin-Ai et al., 2018; Moon et al., 2017). PCR amplifies only specific genes of pathogens, and their presence is confirmed visually, thereby reducing both time and cost. Various modified PCR techniques have been developed to increase detection sensitivity (Kumar et al., 2010; Sun et al., 2023; Zhenyan et al., 2021).
Multiplex PCR is a technology that uses multiple pairs of specific primers to amplify two or more target fragments simultaneously in a single reaction (Chamberlain et al., 1988). This method saves both time and reagents, making it more cost-effective than conventional PCR. Therefore, it provides a fast and reliable means of identifying multiple pathogens or viruses present in plants. Currently, multiplex PCR is used widely to diagnose diseases in various plants, including strawberries, chrysanthemums, orchids, barley, and rice (Ali et al., 2014; Kang et al., 2016; Lee et al., 2017; Villarino et al., 2021; Zhao et al., 2015); however, multiplex PCR methods for diagnosing pathogens in C. kanran (an endangered species) has rarely been reported.
Here, we developed a multiplex PCR assay for efficient and rapid simultaneous detection of four problematic pathogens in C. kanran: Cg, Ps, Fo, and Fp. The optimized multiplex PCR assay was applied to leaf samples collected from C. kanran in its natural habitat to determine the predominant pathogen and its frequency of occurrence.

Materials and Methods

Sample collection

Symptomatic C. kanran leaves were collected from the natural habitat located in Sanghyo-dong, Jeju (Fig. 1). The natural habitat is divided into 11 Zones. Of these, leaves were collected from Zones 1 to 8, with a higher number of leaves collected from Zones 7 and 8, which harbor a large population of C. kanran. A total of 114 leaves (58 samples in June 2022 and 56 samples in August 2022) were collected during two sampling rounds. The leaf samples were placed in plastic bags and stored at −20°C until use.

Pathogen source

The strains Cg (KACC 40003), Ps (KACC 44909), Fo (KACC 41091), and Fp (KACC 40387) were obtained from the Genebank of the Rural Development Administration and stored briefly at 4°C before extraction of genomic DNA (gDNA).

DNA extraction

Total gDNA was extracted from each pathogen strain, and from orchid leaves, using the Exgene Plant SV Kit (GeneAll Biotechnology, Seoul, Korea). The concentration of gDNA was measured using a Nanophotometer (Implen GmbH, Munich, Germany). Extracted gDNA was stored at −20°C prior to use as a template for both conventional and multiplex PCR assays.

PCR primers

Primers based on internal transcribed spacer (ITS) sequences were designed specifically for simultaneous and precise detection of the four pathogens. The ITS sequences for each pathogen were collected from NCBI and aligned using the BioEdit program (version 7.2.5). Primers were designed to amplify fragments of varying lengths to ensure that there were detectable differences between the four species (Supplementary Fig. 1). All primers were synthesized by BIONICS, Seoul, Korea. The oligonucleotide sequences of the primers are shown in Table 1. To confirm the specificity of the primers, they were used to amplify DNA from each single template and healthy plants.

Conventional PCR

Conventional PCR was performed in a 50 μl reaction mixture containing 1 μl of genomic DNA (1 ng/μl), 0.5 μl of 2.5 U Ex Taq (Takara, Kyoto, Japan), 1 μl of each primer (10 pmol), 5 μl of 2.5 mM dNTP mix, 5 μl of 10× reaction buffer (Takara), and 36.5 μl of nuclease-free water. The PCR reaction conditions were as follows: initial denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 65°C for 30 s, and 72°C for 45 s, with a final elongation step at 72°C for 5 min. The PCR products were analyzed by electrophoresis on a 2.25% agarose gel (20 min at 100 V).

Multiplex PCR

To develop the multiplex PCR, specific ITS sequences from each of the four pathogens were amplified simultaneously. PCR conditions were optimized by varying parameters such as the amount and proportion of the primers, the number of PCR cycles, and the annealing temperature. The PCR reaction (50 μl) contained 1 μl of gDNA comprising 1 ng of each gDNA from each pathogen (total, 4 ng), 2.5 U of 0.5 μl of Ex Taq (Takara), 1 μl of each primer (10 pmol), 5 μl of a 2.5 mM dNTP mixture, 5 μl of 10× reaction buffer (Takara), and 30.5 μl of nuclease-free water. The basic PCR reaction conditions were as follows: initial denaturation at 95°C for 5 min, followed by 30-40 cycles of 95°C for 30 s, 55-65°C for 30 s, and 72°C for 45 s, with a final elongation step at 72°C for 5 min. PCR products were analyzed by electrophoresis on a 2.25% agarose gel (20 min at 100 V).

Sensitivity assay

The concentration of gDNA from each pathogen was adjusted to 1 ng/μl. The sensitivity of the PCR assay was evaluated using both conventional and multiplex methods, with the gDNA serially diluted 10-fold from 1 ng/μl to 1 fg/μl. To compare the dilution series, conventional and multiplex PCR were conducted simultaneously.

Validation of the multiplex PCR in C. kanran leaf samples

To evaluate the efficiency of the multiplex PCR assay, symptomatic C. kanran leaves were collected from the natural habitat located in Sanghyo-dong, Jeju. A total of 114 C. kanran leaves were screened for the simultaneous detection of the four pathogens. The composition of the multiplex PCR reaction was as described above, with 1 μl of gDNA from C. kanran leaves (1 ng) used as the template.

Results

Specificity of the primers

The primers were designed to allow specific amplification of each of the four pathogens by aligning their ITS sequences (Supplementary Fig. 1); this yielded PCR products of different sizes (Table 1). The specificity of the four primer pairs was assessed by conventional PCR (Fig. 2). Primer pairs specific for each of the four pathogens amplified the following expected amplicon fragments: 480 bp for Cg, 407 bp for Ps, 321 bp for Fo, and 279 bp for Fp. No non-amplification products were observed. Additionally, the absence of amplification in healthy leaf samples of C. kanran indicates the high specificity of the primer pair, providing confidence in the accuracy of the diagnosis. These data demonstrate that each primer pair is specific for its target pathogen, and is suitable for simultaneous diagnosis of these pathogen diseases.

Optimization of the multiplex PCR

To ensure efficiency of the multiplex PCR to detect the four pathogens, we optimized the following parameters: the amount and ratio of each primer pair; the PCR reaction cycles; and the annealing temperature. After a series of optimizations, the following multiplex PCR conditions were set: All primers were diluted to 10 pmole, and then 1 μl of each was used in the PCR at a 1:1:1:1 ratio. Thus, each PCR reaction contained 1 μl of gDNA (1 ng/μl), 0.5 μl of Ex taq polymerase (2.5 U), 8 μl of the four primer pairs (each 10 pmole), 5 μl of dNTPs (each 2.5 mM), and 5 μl of 10× Ex taq buffer (final volume, 50 μl). The PCR reaction conditions were as follows: initial denaturation at 95°C for 5 min, followed by 35 cycles for 30 s at 95°C, 30 s at 65°C, and 45 s at 72°C, with a final elongation step for 5 min at 72°C. The optimized multiplex PCR confirmed that fragments of the expected sizes (480 bp, 407 bp, 321 bp, and 279 bp for Cg, Ps, Fo, and Fp, respectively) were clearly amplified (Fig. 3).

Sensitivity assays of conventional and multiplex PCR

The concentration of gDNA extracted from the four pathogens was adjusted to 1 ng/μl, followed by 10-fold serial dilution to 1 fg/μl; the sensitivity of the PCR was then evaluated from 1 ng to 1 fg gDNA. The detection limit of each single DNA template evaluated using conventional PCR varied between pathogens: Cg was detected at 0.1 pg, which was the lowest concentration among the four pathogens; Ps was detected at 1 pg, and Fo and Fp were detected at 0.01 ng (Fig. 4A-D). For the multiplex PCR, equal concentrations of gDNA from the four pathogens were mixed, and the detection limits were confirmed. Cg, Ps, Fo, and Fp could be detected simultaneously down to a concentration of 0.1 ng (Fig. 4E).

Screening of C. kanran leaf samples to detect the four pathogens

The multiplex PCR assay optimized in this study was used to screen C. kanran leaf samples that showed symptoms. A total of 114 C. kanran leaf samples, 58 from the first round and 56 from the second round, were collected for disease diagnosis. After multiplex PCR, the PCR products were analyzed by electrophoresis on a 2.25% gel. Representative results obtained after electrophoresis of C. kanran leaves are shown in Fig. 5. We identified infection with a single pathogen (lane 8), and co-infection with two pathogens (lanes 1, 2, and 9), three pathogens (lane 4), or four pathogens (lanes 3, 5, 6, 7, and 10). Screening results for 114 samples revealed that the most frequently detected pathogen in C. kanran leaves was Cg (60 samples, 53%), followed by Ps (56 samples, 49%), Fp (32 samples, 28%), and Fo (28 samples, 25%) (Tables 2 and 3). Among these, 14 samples were infected with a single pathogen (12%), 29 with two pathogens (25%), 16 with three pathogens (14%), and 14 with four pathogens (12%) (Tables 2 and 3).

Discussion

Early and accurate detection of plant diseases is crucial for minimizing crop losses and establishing effective pathogen control strategies. Here, we developed a rapid and accurate multiplex PCR technique to detect four problematic pathogens (Cg, Ps, Fo, and Fp) in C. kanran. This multiplex PCR method was applied to symptomatic C. kanran leaf samples to diagnose infections.
Designing specific primers for each pathogen is critical for a multiplex PCR assay. The ITS is a conserved sequence that varies between species, making it effective for distinguishing strains (Henry et al., 2000). The high copy number of the rRNA cluster in the ITS region allows easy amplification using only a small amount of DNA (Baldwin et al., 1995); therefore, several studies report simultaneous detection of pathogens by amplification of ITS sequences using multiplex PCR and nested multiplex PCR (Rahman et al., 2020; Villarino et al., 2021; Zhenyan et al., 2021). In this study, primer pairs targeting four pathogens (Cg, Ps, Fo, and Fp), and designed based on the ITS sequences, amplified expected fragments of 480 bp, 407 bp, 321 bp, and 279 bp, respectively, demonstrating their target specificity (Fig. 2).
Multiplex PCR is a sensitive and rapid detection method that reduces experimental costs and time; however, it can present experimental difficulties. Since multiplex PCR uses multiple primers and templates in a single reaction, interference may occur between some of the primers and the corresponding template, thereby affecting the results (Elnifro et al., 2000). An improper annealing temperature and/or PCR cycle may amplify non-specific bands, thereby reducing the amplification efficiency and sensitivity for a particular target. Therefore, optimization of several parameters, including the amount of primer mixture, the optimal annealing temperature, and the number of cycles is essential. We successfully optimized the reaction conditions for the multiplex PCR method developed in this study, and established an efficient amplification method suitable for simultaneous detection of four types of pathogen (Fig. 3).
The sensitivity of the conventional PCR for the four pathogens tested in this study ranged from 1 ng to 1 fg. The detection limits for Cg, Fo, and Fp were lower than those reported in previous studies (Shengfan et al., 2022; Villarino et al., 2021; Zhenyan et al., 2021), although no previous reports provide data for Ps. The sensitivity of the multiplex PCR was 0.1 ng, which is lower than that of conventional PCR (Fig. 4). This difference in sensitivity may be because the four pairs of primers compete for a single reagent in the conventional PCR (Roy et al., 2005). Additionally, the presence of more than one primer pair in the multiplex PCR leads to unbalanced amplification intensity, yielding different detection limits for each target (Sint et al., 2012).
The four pathogens (Cg, Ps, Fo, and Fp) grow rapidly at temperatures between 25 and 30°C, and in high humidity conditions (Cruz et al., 2019; Marin et al., 1995; Sharma and Kulshrestha, 2015; Sultana et al., 2021); therefore, we harvested leaves of C. kanran in June and August, which are favorable environmental conditions for the growth of these pathogens, and then applied the multiplex PCR developed in this study. Among the four pathogens tested, the most dominant pathogen in leaf samples collected from the natural habitat located in Sanghyo-dong, Jeju, was Cg (53%), followed by Ps (49%), Fp (28%), and Fo (25%) (Tables 2 and 3). Additionally, approximately 80% of the leaves in which pathogens were detected were co-infected with two or more pathogens.
In conclusion, the multiplex PCR established in this study is a rapid and reliable method for detecting problematic pathogens in C. kanran. Therefore, this analysis method is useful for the early diagnosis of pathogens present in C. kanran, and may also provide important data for future development of diagnostic methods targeting other pathogens.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the Ministry of Education (2016R1A6A1A03012862), and by the Jeju Smoothlip Cymbidium habitat pest diagnosis and control Project.

Electronic Supplementary Materials

Supplementary materials are available at The Plant Pathology Journal website (http://www.ppjonline.org/).

Fig. 1
Representative photographs of Cymbidium kanran leaves showing symptoms of disease.
ppj-oa-07-2024-0101f1.jpg
Fig. 2
Specificity of the pathogen-specific primer pairs for Colletotrichum gloeosporioides (Cg), Pestalotiopsis sp. (Ps), Fusarium oxysporum (Fo), and Fusarium proliferatum (Fp). (A) Cg-F + R. (B) Ps-F + R. (C) Fo-F + R. (D) Fp-F + R. Lane 1, healthy plant; lane 2, Cg (480 bp); lane 3, Ps (407 bp); lane 4, Fo (321 bp); lane 5, Fp (279 bp); M, 50 bp DNA size marker.
ppj-oa-07-2024-0101f2.jpg
Fig. 3
Optimization of multiplex PCR performed by mixing the primers specific for four pathogens. Lane 1, Colletotrichum gloeosporioides (Cg, 480 bp); lane 2, Pestalotiopsis sp. (Ps, 407 bp); lane 3, Fusarium oxysporum (Fo, 321 bp); lane 4, Fusarium proliferatum (Fp, 279 bp); lane 5, Cg + Ps + Fo + Fp; M, 50 bp DNA size marker.
ppj-oa-07-2024-0101f3.jpg
Fig. 4
Detection limits of the conventional and multiplex PCR assays. (A) Colletotrichum gloeosporioides (Cg, 480 bp). (B) Pestalotiopsis sp. (Ps, 407 bp). (C) Fusarium oxysporum (Fo, 321 bp). (D) Fusarium proliferatum (Fp, 279 bp). (E) Cg + Ps + Fo + Fp. Lanes 1-7, 10-fold serial dilutions of the genomic DNA template (1 ng/μl-1 fg/μl); M, 50 bp DNA size marker.
ppj-oa-07-2024-0101f4.jpg
Fig. 5
Representative multiplex PCR results for the four pathogens in 10 samples of Cymbidium kanran leaves. Lanes 1-10, symptomatic C. kanran leaf samples; M, 50 bp DNA size marker; P, positive control; Cg, Colletotrichum gloeosporioides; Ps, Pestalotiopsis sp.; Fo, Fusarium oxysporum; Fp, Fusarium proliferatum.
ppj-oa-07-2024-0101f5.jpg
Table 1
Sequences of the oligonucleotide primers, and the size of the amplicons
Pathogen Primer Sequence (5′-3′) Amplicon (bp) Gene Gene ID
Colletotrichum gloeosporioides Cg F ACCTGCGGAGGGATCATTAC 480 ITS/rRNA KX098303
Cg R GCAAGAGTCCCTCCGGATCC
Pestalotiopsis sp. Ps F CCTACCCTGTAGCGCCTTAC 407 ITS/rRNA MN699305
Ps R CTAAAGACGCTGCAACTCCAG
Fusarium oxysporum Fo F GCTCCCGGTAAAACGGGACG 321 ITS/rRNA MT557518
Fo R GCTCGACGTGACCGCCAATC
Fusarium proliferatum Fp F GCTCCCGGTAAAACGGGACG 279 ITS/rRNA MK816856
Fp R GATCCCCAACACCAAACCCGA

ITS, internal transcribed spacer.

Table 2
Multiplex PCR screening of symptomatic Cymbidium kanran leaf samples
Sample ID Disease Sample ID Disease Sample ID Disease Sample ID Disease




Cg Ps Fo Fp Cg Ps Fo Fp Cg Ps Fo Fp Cg Ps Fo Fp
1-01 + + 3-10 + + + + 6-08 + + 8-01
1-02 + 4-01 + + + + 6-09 + 8-02 + + +
1-03 4-02 6-10 + 8-03
1-04 4-03 7-01 8-04 + + + +
1-05 + 4-04 7-02 + + + + 8-05
1-06 + + 4-05 + + + 7-03 + + + + 8-06 + + +
1-07 + + + 4-06 + + + + 7-04 + + + 8-07 +
1-08 + + 4-07 + + + + 7-05 + + 8-08 + +
1-09 + + + 4-08 + 7-06 + + 8-09 +
1-10 + + + 4-09 + + 7-07 + + 8-10 + +
2-01 + 4-10 + + + + 7-08 8-11
2-02 + + + + 5-01 7-09 8-12 + + +
2-03 5-02 7-10 + + 8-13 + +
2-04 5-03 7-11 + + 8-14
2-05 5-04 + + + + 7-12 + + 8-15
2-06 + + + 5-05 7-13 + + + + 8-16
2-07 + + 5-06 7-14 + 8-17
2-08 + + 5-07 + + 7-15 + + + + 8-18 + +
2-09 + + + 5-08 7-16 + + 8-19
2-10 + + + 5-09 + + 7-17 + + 8-20 +
3-01 5-10 + + + 7-18 + + 8-21
3-02 5-11 + + + 7-19 + 8-22
3-03 6-01 + + + + 7-20 + + 8-23
3-04 6-02 + + + 7-21 + + 8-24 + +
3-05 6-03 7-22 8-25 +
3-06 + + 6-04 7-23 + + 8-26
3-07 + + 6-05 7-24 + 8-27
3-08 + + + + 6-06 + + + 7-25
3-09 + + + 6-07 + 7-26 + +

Cg, Colletotrichum gloeosporioides; Ps, Pestalotiopsis sp.; Fo, Fusarium oxysporum; Fp, Fusarium proliferatum.

Table 3
Detection of the four pathogens in symptomatic Cymbidium kanran leaf samples by multiplex PCR
No. of samples infected with pathogens (%)a No. of single or co-infected samples (%)b


Cg Ps Fo Fp One pathogen Two pathogens Three pathogens Four pathogens
60 (53) 56 (49) 28 (25) 32 (28) 14 (19) 29 (40) 16 (22) 14 (19)

Cg, Colletotrichum gloeosporioides; Ps, Pestalotiopsis sp.; Fo, Fusarium oxysporum; Fp, Fusarium proliferatum.

a Percentage of samples infected with a pathogen (out of 114 C. kanran leaf samples).

b Percentage of single or co-infected samples (out of 73 C. kanran leaf samples infected with a pathogen).

References

Ali, R. N., Dann, A. L., Cross, P. A. and Wilson, C. R. 2014. Multiplex RT-PCR detection of three common viruses infecting orchids. Arch. Virol. 159:3095-3099.
crossref pmid pdf
Arditti, J. and Pridgeon, A. M. 1997. Orchid biology: reviews and perspectives, VII. Kluwer Academic Publishers, Dordrecht, Netherlands. pp. 394.
Baldwin, B. G., Sanderson, M. J., Porter, J. M., Wojciechowski, M. F., Campbell, C. S. and Donoghue, M. J. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann. Mo. Bot. Gard. 82:247-277.
crossref
Chamberlain, J. S., Gibbs, R. A., Rainer, J. E., Nguyen, P. N. and Thomas, C. T. 1988. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16:11141-11156.
crossref pmid pmc
Cruz, D. R., Leandro, L. F. S. and Munkvold, G. P. 2019. Effects of temperature and pH on Fusarium oxysporum and soybean seedling disease. Plant Dis. 103:3234-3243.
crossref pmid
Du Puy, D. and Cribb, P. 1988. The classification of Cymbidium. In: The genus Cymbidium, eds. by D. Du Puy and P. Cribb, pp. 50-194. Kew Publishing, Royal Botanic Garden, Kew, UK.
Elnifro, E. M., Ashshi, A. M., Cooper, R. J. and Klapper, P. E. 2000. Multiplex PCR: optimization and application in diagnostic virology. Clin. Microbiol. Rev. 13:559-570.
crossref pmid pmc pdf
Han, K.-S., Park, J.-H., Back, C.-G. and Park, M.-J. 2015. First report of Fusarium subglutinans causing leaf spot disease on Cymbidium orchids in Korea. Mycobiology 43:343-346.
crossref pmid pmc
Henry, T., Iwen, P. C. and Hinrichs, S. H. 2000. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38:1510-1515.
crossref pmid pmc pdf
Jeju Province World Natural Heritage Center 2020 Establishment of Jeju Cymbidium kanran habitat management plan and biological research URL https://www.prism.go.kr/homepage/entire/researchDetail.do?researchId=6500000-202000117&gubun=totalSearch&menuNo=I0000002 10 July 2024.
Jin-Ai, Y., Peng, H., Cheng-Zhong, L. and De-Yi, Y. 2018. Stem rot on Cymbidium ensifolium (Orchidaceae) caused by Fusarium oxysporum in China. Can. J. Plant Pathol. 40:105-108.
crossref
Kang, I. J., Kang, M.-H., Noh, T.-H., Shim, H. K., Shin, D. B. and Heu, S. 2016. Simultaneous detection of three bacterial seed-borne diseases in rice using multiplex polymerase chain reaction. Plant Pathol. J. 32:575-579.
crossref pmid pmc
Kumar, T. D. K., Murali, H. S. and Batra, H. V. 2010. Multiplex PCR assay for the detection of enterotoxic Bacillus cereus group strains and its application in food matrices. Indian J. Microbiol. 50:165-171.
crossref pmid pmc pdf
Lee, B.-C., Bae, J.-Y., Kim, S.-M., Ra, J.-E., Choi, N. J., Choi, M. Y. and Park, K. D. 2017. Simultaneous detection of barley virus diseases in Korea. Res. Plant. Dis. 23:363-366 (in Korean).
crossref pdf
Lee, B. D., Kim, W. G., Cho, W. D. and Sung, J. M. 2002. Occurrence of dry rot on Cymbidium orchids caused by Fusarium spp. in Korea. Plant Pathol. J. 18:156-160.
Maharachchikumbura, S. S. N., Hyde, K. D., Groenewald, J. Z., Xu, J. and Crous, P. W. 2014. Pestalotiopsis revisited. Stud. Mycol. 79:121-186.
crossref pmid pmc
Marin, S., Sanchis, V. and Magan, N. 1995. Water activity, temperature, and pH effects on growth of Fusarium moniliforme and Fusarium proliferatum isolates from maize. Can. J. Microbiol. 41:1063-1070.
crossref pmid
Michielse, C. B. and Rep, M. 2009. Pathogen profile update: Fusarium oxysporum. Mol. Plant Pathol. 10:311-324.
crossref pmid pmc
Moon, H., Park, H.-J., Jeong, A.-R., Han, S.-W. and Park, C.-J. 2017. Isolation and identification of Burkholderia gladioli on Cymbidium orchids in Korea. Biotechnol. Biotechnol. Equip. 31:280-288.
crossref pdf
Park, J.-H. and Seo, S.-T. 2013. First report of anthracnose of smoothlip Cymbidium (Cymbidium kanran) caused by Colletotrichum gloeosporioides in Korea. Plant Dis. 97:997.
crossref
Park, M.-J., Back, C.-G. and Park, J.-H. 2020. Colletotrichum cymbidiicola causing anthracnose on Cymbidium orchids in Korea. Mycobiology 48:321-325.
crossref pmid pmc
Rahman, A., Miles, T. D., Martin, F. N. and Quesada-Ocampo, L. M. 2017. Molecular approaches for biosurveillance of the cucurbit downy mildew pathogen, Pseudoperonospora cubensis. Can. J. Plant Pathol. 39:282-296.
crossref
Rahman, H. U., Yue, X., Ren, X., Zhang, W., Zhang, Q. and Li, P. 2020. Multiplex PCR assay to detect Aspergillus, Penicillium and Fusarium species simultaneously. Food Addit. Contam. Part A. 37:1939-1950.
crossref
Roy, A., Fayad, A., Barthe, G. and Brlansky, R. H. 2005. A multiplex polymerase chain reaction method for reliable, sensitive and simultaneous detection of multiple viruses in citrus trees. J. Virol. Methods 129:47-55.
crossref pmid
Sharma, M. and Kulshrestha, S. 2015. Colletotrichum gloeosporioides: an anthracnose causing pathogen of fruits and vegetables. Biosci. Biotechnol. Res. Asia 12:1233-1246.
crossref
Shengfan, H., Junjie, L., Tengfei, X., Xuefeng, L., Xiaofeng, L., Su, L. and Hongqing, W. 2022. Simultaneous detection of three crown rot pathogens in field-grown strawberry plants using a multiplex PCR assay. Crop Prot. 156:105957.
crossref
Sint, D., Raso, L. and Traugott, M. 2012. Advances in multiplex PCR: balancing primer efficiencies and improving detection success. Methods Ecol. Evol. 3:898-905.
crossref pmid pmc pdf
Sultana, A., Sikder, M. M., Ahmmed, M. S., Sultana, S. and Alam, N. 2021. First report of pre-harvest amla fruit rots disease caused by Pestalotiopsis sp. in Bangladesh. Jahangirnagar Univ. J. Biol. Sci. 10:71-81.
crossref pdf
Sun, A., Wang, L., Zhang, Y., Yang, X., Wei, Y., Yang, D., Li, W. and Wu, X. 2023. Establishment of a triplex TaqMan quantitative real-time PCR assay for simultaneous detection of Cymbidium mosaic virus, Odontoglossum ringspot virus and Cymbidium ringspot virus. Front. Microbiol. 14:1129259.
crossref pmid pmc
Villarino, M., De Cal, A., Melgarejo, P. and Larena, I. 2021. Development of a multiplex PCR for the identification of Fusarium solani and F. oxysporum in a single step. J. Plant Dis. Prot. 128:1275-1290.
crossref pdf
Zhao, X., Liu, X., Ge, B., Li, M. and Hong, B. 2015. A multiplex RT-PCR for simultaneous detection and identification of five viruses and two viroids infecting chrysanthemum. Arch. Virol. 160:1145-1152.
crossref pmid pdf
Zhenyan, C., Yihua, Y., Yang, S., Xuping, S. and Xiaoping, Y. 2021. Simultaneous detection of four pathogens in Dendrobium officinale by nested multiplex PCR assay. Crop Prot. 140:105445.
crossref


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next