Plant Pathol J > Volume 41(1); 2025 > Article
Song and Kong: Effects of Temperature on Resistance to Streptomycin in Xanthomonas arboricola pv. pruni

Abstract

Xanthomonas arboricola pv. pruni (Xap) causes the shot hole disease of stone fruits and almonds. This bacterium is a damaging, widespread pathogen distributed across the major stone fruit producing regions of the world. To control shot hole disease, antibiotics such as streptomycin are mainly used. However, as concerns about antibiotic resistance increase, many restrictions are placed on the use of antibiotics. Additionally, it has been reported that the rise in temperature due to climate change affects disease occurrence and ecology. Therefore, in this study, we determined the minimum inhibitory concentration (MIC) of streptomycin for Xap at an optimal growth temperature of 28°C and investigated the changes in MIC and the occurrence frequency of resistant bacteria at 10°C, 25°C and 30°C. The results of this study showed that the MIC was 30 μg/ml at 28°C. In addition, when the change in streptomycin resistance concentration due to temperature was confirmed, we found that the resistance concentration decreased to 10 μg/ml at 30°C. When the occurrence of resistance according to concentration and temperature conditions was investigated, the occurrence frequency of resistant strains was found to be the highest at 50 μg/ml. In the case of temperature, the occurrence frequency of resistant strains was confirmed to be high at 30°C. These results provide basic data for further reducing the problem of antibiotic resistance by suggesting the possibility of changes in the occurrence of streptomycin-resistant strains depending on the antibiotic treatment environment.

Xanthomonas arboricola is a complex of plant pathogenic bacteria with a broad host range (Fischer-Le Saux et al., 2015; Lamichhane and Varvaro, 2014). X. arboricola is classified into nine pathovars, depending on the host range of the species: X. arboricola pv. arracaciae, X. arboricola pv. populi, X. arboricola pv. pruni, X. arboricola pv. corylina, X. arboricola pv. juglandis, X. arboricola pv. celebensis, X. arboricola pv. guizotiae, X. arboricola pv. fragariae, and X. arboricola pv. zantesdeschiae (Fischer-Le Saux et al., 2015). Among these pathogens, X. arboricola pv. corylina, X. arboricola pv. juglandis, and X. arboricola pv. pruni are considered to be the most virulent and economically important (Fischer-Le Saux et al., 2015).
X. arboricola pv. pruni (Xap) causes shot hole disease, a major disease of stone fruit trees and almonds worldwide (Garita-Cambronero et al., 2018; Stefani, 2010). Symptoms of the disease include angular necrotic spots on leaves, branches, and fruits and, in severe cases, weakening of the tree and decreased productivity (Garita-Cambronero et al., 2018). Xap can survive the winter in cankers on infected branches and in leaf debris left on the ground, a feature that increases the survival of the pathogen and makes disease control difficult (Palacio-Bielsa et al., 2010; Roselló et al., 2012).
To control bacterial diseases of plants, antibiotics such as streptomycin, oxytetracycline, kasugamycin, oxolinic acid (OA), and gentamicin are reported to be the most used in agriculture (McManus, 2002; Miller et al., 2022; Sundin and Wang, 2018). Streptomycin, the most widely used antibiotic, is an aminoglycoside that inhibits protein synthesis in bacteria and has been used for agricultural purposes since the 1950s (Sundin and Wang, 2018). The use of streptomycin to control bacterial diseases of crops is legal in Asia, New Zealand, India, and the United States of America, but its use in plant agriculture is banned in Europe and Africa, because of concerns regarding the emergence of resistance (Verhaegen et al., 2023).
The strA and strB genes are the most widely distributed streptomycin resistance determinants (Sundin and Wang, 2018). This gene pair is distributed globally in a variety of Gram-negative bacteria isolated from plants, animals, and various environmental samples (Mindlin and Petrova, 2017; Tancos and Cox, 2017; van Overbeek et al., 2002). Another resistance mechanism involves point mutations in the streptomycin target site. Streptomycin interferes with protein synthesis by attaching to the S12 protein encoded by the rpsL gene found in the 30S ribosomal subunit. Alteration of a nucleotide in in codon 43 (AAA) of the rpsL gene, which encodes a streptomycin-sensitive lysine, to AGA (arginine), AAT/C (asparagine), or ACA (threonine) confers a resistance phenotype (Cameron and Sarojini, 2014; Sundin and Wang, 2018).
Recent studies have highlighted the significant impact of temperature on cellular, physiological, ecological, and evolutionary mechanisms that affect the survival of bacteria (Rodríguez-Verdugo et al., 2020). Climate change can promote plant diseases through changes in host-pathogen interactions, alterations in pathogen physiology, and the emergence of new pathogens (Cohen and Leach, 2020; Newbery et al., 2016; Velásquez et al., 2018). However, we have limited knowledge regarding how interactions among the different components of climate change will affect plant pathogens in agricultural and natural ecosystems.
We hypothesized that changes in temperature may lead to the emergence of resistant Xap strains. In this study, we confirmed the change in Xap resistance to streptomycin according to temperature and the occurrence frequency of resistant strains. In addition, we analyzed the genetic mutations in selected resistant strains to examine the occurrence of mutations and related genes. These results can be used as basic data for reducing the occurrence of resistance due to the use of agricultural antibiotics.

Materials and Methods

Bacterial distribution and culture

To confirm antibiotic resistance, Xanthomonas arboricola pv. pruni (Xap) strain KACC 19949 was obtained from the Korean Agricultural Culture Collection (KACC) of the National Institute of Agricultural Science. The strain was stored as a stock culture at −80°C.

Minimum inhibitory concentration analysis of Xap in response to streptomycin treatment

To measure the minimum inhibitory concentration (MIC) of streptomycin against Xap, streptomycin was added to the LB medium (Difco, Becton Dickinson, Sparks, MD, USA) at different final concentrations (0.25, 0.5, 1, 2, 4, 10, 20, 30, 40, 50, 100, and 1,000 μg/ml). Xap strains were seed-cultured in 5 ml of LB medium (Luria Bertani medium, Difco, Becton Dickinson) at 28°C for 24 h. Then, 100 μl of seed culture was used to inoculate 1 ml of LB medium containing streptomycin at a certain concentration in a 15-ml Falcon tube and cultured for 24 h at 28°C, with shaking at 120 rpm. Bacterial growth was evaluated by measuring the optical density at 600 nm using a Synergy HT MultiMode Microplate Reader (BioTek Instruments, Winooski, VT, USA), and growth was considered to have occurred if the absorbance was 0.1 or higher (Lyu et al., 2019). Subsequently, the culture was diluted to 10−6 to determine the viable cell count, and the colony count was measured after spreading the culture on LB agar plates.

Changes in streptomycin resistance due to temperature

The streptomycin resistance of Xap at low temperatures was tested through culturing at 10°C; however, since bacterial growth was insufficient, the bacteria were incubated in antibiotic media at each temperature for 24 h instead of culturing, and then bacterial growth was compared by culturing at 28°C. After adjusting the OD600 to 1.0 using the seed culture of Xap in LB medium for 24 h, 100 μl of the seed culture was added to 15-ml Falcon tubes containing 1 ml of LB medium containing streptomycin at a certain concentration. After culturing at 10°C, 25°C, and 30°C for 24 h with shaking at 125 rpm, the liquid medium at each concentration was transferred to a 1.5-ml tube and centrifuged at 13,000 rpm for 3 min.
After removing the supernatant, 1 ml of sterilized water was added back into the 1.5-ml tube, vortexed, and centrifuged, leaving behind only the pellet. This process was repeated twice. Afterwards, the washed pellet was suspended in 1 ml of LB medium. Then, 100 μl of each the suspension was added to a test tube containing 900 μl of LB medium and incubated, with shaking, at 28°C for 24 h, and the absorbance was measured; absorbance > 0.1 was considered to indicate growth.
Through the newly established process, the bacteria that grew depending on the temperature in each antibiotic were washed to remove the antibiotics present in the medium and replaced with LB medium, thereby clearly confirming the growth of the bacteria. The samples were serially diluted to 10−6, plated on LB agar, and the colonies were enumerated to determine cfu.

Changes in occurrence frequency of streptomycin-resistant bacteria according to temperature

To determine the occurrence frequency of antibiotic resistance at 28°C, 100 μl of LB medium was added to a 96-well plate with streptomycin concentrations of 10, 25, and 50 μg/ml. Then, 10 μl of the Xap suspension (OD600 = 0.1), prepared by culturing the strain in LB medium for 24 h, was inoculated and cultured in a shaking incubator at 120 rpm for 3 days. Absorbance was measured at 600 nm. Each well with a value of 0.1 or higher was inoculated into LB agar medium containing 100 μg/ml streptomycin by dipping a sterilized toothpick into the medium. To check the frequency of resistance caused by temperature, 10 μl of the LB-cultured suspension (OD600 = 0.1) was inoculated into 100 μl of LB medium containing 25 μg/ml streptomycin in a 96-well plate, and incubated at 20°C, 25°C, 28°C, and 30°C following the same procedure as above.

Genetic mutation analysis of resistant bacteria

Primers listed in Table 1 were used to amplify and analyze the strA, strB, and rpsL genes of streptomycin-resistant strains. The strA gene was amplified using the strAP-F and strAT-R primers, and the strB gene was amplified with strBP-F and strBT-R primers. These primers were used as described in Herbert et al. (2022). PCR conditions were as follows: denaturation at 95°C for 5 min, followed by 34 repetitions of denaturation at 95°C for 15 s, annealing at 55°C for 20 s, and extension at 72°C for 90 s, and a final extension at 72°C for 5 min. The PCR amplification of the 16S rRNA gene was performed using universal primers, 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-TACGGYTACCTTGTT-ACGACTT-3′). The PCR conditions consisted of initial denaturation at 96°C for 4 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 1 min, and a final extension at 72°C for 10 min.
To amplify the rpsL gene, specific primers (rpsL-F and rpsL-R) were designed using the Primer 3 online program (https://primer3.ut.ee/) based the Xap genome information in the NCBI database, and the specificity of the primers was confirmed using BLAST. The PCR conditions included an initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 60 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, and a final extension at 72°C for 5 min. Following the final extension, the reaction was held at 4°C for storage. The PCR reaction solution consisted of 2 μl of 10× reaction buffer, 0.4 μl of 10 mM dNTP, 1 μl of each primer (10 mM), 0.1 μl of 5.0 U of Tap DNA polymerase (BioFact Inc., Daejeon, Korea), and 2 μl of genomic DNA template (50 ng/μl). The amplified gene fragment was verified using 1.5% agarose gel electrophoresis in 0.5× TBE buffer, followed by bidirectional sequencing analysis performed by Macrogen Inc. (Seoul, Korea).

Statistical analysis

The experimental results were analyzed using the R software. Differences in the occurrence frequency of resistant strains were assessed through ANOVA, followed by Tukey’s HSD post hoc test, and significant differences between treatment groups were identified at P < 0.05. The results were grouped and presented in a bar plot.

Results

Measurement of MIC of Xap against streptomycin at incubation temperature

To measure the MIC of Xap against streptomycin at 28°C, the degree of bacterial growth in streptomycin (0.25 to 1,000 μg/ml) was determined by measuring absorbance. In the case of medium without antibiotics, the absorbance was 0.7 ± 0.04 at OD600 after 24 h, and it was confirmed that the absorbance was maintained at 0.5 at OD600 in concentrations up to 10 μg/ml of streptomycin (Fig. 1A).
On the other hand, it was confirmed that bacteria could not be cultured at a concentration of 20 μg/ml or higher (Fig. 1A). In order to measure the MIC more precisely, the concentration was increased by 2 μg/ml from 10 μg/ml to 20 μg/ml to check the degree of growth. As a result, at 18 μg/ml, OD600 decreased to 0.25 ± 0.009, and it was confirmed that bacteria were not cultured at 20 μg/ml (Fig. 1B). Therefore, the MIC of Xap streptomycin at 28°C was confirmed to be 20 μg/ml. The MIC was measured using the dilution plate method to check the number of viable bacteria according to the antibiotic concentration. As a result, the number of viable bacteria decreased by half (to a total of 104 cfu/ml) from 10 μg/ml to 20 μg/ml, and it was confirmed that bacteria were not cultured at 30 μg/ml (Fig. 1C).

Analysis of change in the response of Xap to streptomycin due to temperature

To test the change in the MIC of Xap against streptomycin due to temperature, bacterial growth was measured at concentrations ranging from 5 to 25 μg/ml. In order to analyze the response of antibiotics to changes in temperature, a new method for testing the changes in antibiotics according to temperature was established (Fig. 2A). As a result of confirming the change in antibiotic response due to temperature through the obtained method, the culture concentration of bacteria was found to be up to 10 μg/ml at 10°C, which was not statistically different from the medium without antibiotics. On the other hand, at a concentration of 15 μg/ml, an OD600 value of 0.2 was observed, indicating approximately half the growth, while no growth was confirmed at 20 μg/ml, indicating that culture did not occur (Fig. 2B).
At 25°C, the medium without antibiotics had a culture concentration with an OD600 of 0.7 ± 0.02, while the medium containing 10 μg/ml antibiotics showed an OD600 value of 0.7 ± 0.02, which was indicative of statistically significant inhibition of bacterial growth (Fig. 2C). On the other hand, at 30°C, the OD600 value of the medium without antibiotics was 0.8 ± 0.03, and it was confirmed that OD600 value decreased sharply to 0.1 at a concentration of 10 μg/ml (Fig. 2D). At 15 μg/ml, it was confirmed that the OD600 value was the same as that of the untreated bacteria at both 25°C and 30°C (Fig. 2). When examining the response to antibiotic concentrations at different temperatures, it was observed that a concentration of 20 μg/ml did not support any growth at any of the tested temperatures. At a concentration of 10 μg/ml, the 10°C treatment group showed no statistically significant difference compared with the medium without antibiotics. However, the resistance of Xap to streptomycin was confirmed to increase at 30°C compared with 10°C and 25°C (Fig. 2B-D). In addition, when the viable cell count was measured using the dilution plate method, the viable cell count decreased statistically significantly from 15 μg/ml at all concentrations. Specifically, a decrease in the viable cell count was observed at 10 μg/ml at 30°C compared with 10°C and 20°C (Fig. 2E-G). These results suggest that the response of bacteria to antibiotics may vary depending the temperature.

Analysis of change in the frequency of Xap resistance to streptomycin caused by temperature

As a result of the above, it was possible to verify the change in the MIC of Xap in relation to streptomycin concentration at different temperatures. Additionally, a 96-well plate system was constructed to study not only the change in MIC but also the frequency of occurrence of resistant colonies (Fig. 3A). After inoculating the Xap cultures into each 96-well plate, the occurrence of resistant bacteria was observed at each concentration, and resistance was further validated on a solid medium containing antibiotics at a concentration of 100 μg/ml (Fig. 3A).
For each streptomycin concentration, growth was observed in six replicates using a 96-well system, resulting in a total of 876 wells. As a result, 692 wells were used for culturing at 10 μg/ml, 257 wells at 25 μg/ml, and 319 wells at 50 μg/ml (Fig. 3B). The culture was collected from each well and plated on LB solid medium containing 100 μg/ml streptomycin to assess the presence or absence of resistance. On the solid medium, resistant bacteria were confirmed to grow in 8 wells out of 507 for 10 μg/ml, 7 wells out of 205 for 25 μg/ml, and 7 wells out of 92 for 50 μg/ml (Fig. 3C). Therefore, the exact rate of resistant bacterial occurrence was determined by dividing the number of wells with resistant colonies by the total number of wells with cultured bacteria. The rate of resistant bacterial occurrence was calculated as 1.6% at 10 μg/ml, 3.4% at 25 μg/ml, and 7.6% at 50 μg/ml, indicating an increase in the occurrence rate with rising streptomycin concentration (Fig. 3D).
The occurrence frequency of resistance according to temperature was tested in seven replicates (Fig. 4A). The ratio of wells cultured to wells containing 25 μg/ml streptomycin was 0.48% (6 wells out of 1224) at 20°C, 4.5% (40 out of 780) at 25°C, 6.8% (75 out of 966) at 28°C, and 6.2% (45 out of 750) at 30°C (Fig. 4B). When the culture fluid was collected from the wells and dispensed on solid medium containing 100 μg/ml streptomycin, fluid from zero wells showed growth at 20°C, 2 wells at 25°C, 8 wells at 28°C, and 15 wells at 30°C (Fig. 4C). The number of wells cultured in the primary culture medium and the occurrence rate of resistant strains on the secondary solid medium were the highest (6.5% at 25°C, 10.7% at 28°C, and 33.3% at 30°C). On the other hand, no resistant strains appeared in the secondary culture at 20°C (Fig. 4D).

Genetic mutation assay of resistant colonies

In order to identify genetic mutations in the resistant colonies cultured in the second experiment, the analysis focused on insertions in the strA and strB genes, known as existing resistance mechanisms, and point mutations in the rpsL gene. After selecting resistant colonies that had undergone secondary culture at each temperature, DNA was extracted, and PCR was performed using each specific primer. As a result, in the case of positive control, the strA and strB genes were detected, whereas in the isolated resistant strain, the strA and strB genes were not observed (Fig. 5A).
In the case of point mutation occurrence in the rpsL gene, point mutations in the rpsL gene were not confirmed in the streptomycin-sensitive strain (S) and in the strain cultured only in the primary well (SR) (Fig. 5B). On the other hand, in the strain cultured on secondary solid medium, it was revealed that alanine (A) was converted to glycine (G) in codon 88 (Fig. 5B).

Discussion

The additional stress on bacteria caused by temperature is critical to understanding the emergence and evolution of antibiotic resistance in the environment. Most studies have indicated that the frequency of antibiotic exposure can act as a selective pressure, promoting the development of antibiotic resistance (Andersson and Hughes, 2014). However, little is understood about how non-antibiotic environmental factors can influence antibiotic resistance selection and mutagenesis.
In this study, we used Xap to focus on the evolution of antibiotic development in microbial populations exposed to different temperature factors simultaneously with antibiotic stress at MIC concentrations (25 μg/ml). The results of the study showed that changes in the MIC of pathogens occurred when temperature (10°C, 25°C, and 30°C) and antibiotics were treated simultaneously. Additionally, it was confirmed that when exposed to only antibiotics, the rate of resistance occurrence was similar depending on the concentration (Fig. 3). However, when exposed to various temperatures in addition to antibiotics, there was no statistically significant difference, but the incidence of resistance increased as the temperature increased (Fig. 4).
This study explores the impact of temperature changes on the development of antibiotic resistance, closely linking it to previous research. Cruz-Loya et al. (2019) suggested that environmental stressors, such as temperature, could drive the development of antibiotic resistance, while VanBogelen and Neidhardt (1990) demonstrated that ribosomes in Escherichia coli act as sensors for temperature changes. Regarding temperature, in E. coli the protein expression profile induced by aminoglycoside antibiotics, specifically gentamicin, tobramycin, and streptomycin, was found to be similar to that induced under heat shock (Cruz-Loya et al., 2019; VanBogelen and Neidhardt, 1990). These results were likely caused by the similarity between temperature-induced protein unfolding and the accumulation of misfolded proteins resulting from translation errors triggered by aminoglycosides. Accordingly, heat shock-induced overexpression of the chaperones DnaK and GroEL has been reported to confer resistance to aminoglycoside antibiotics in E. coli (Goltermann et al., 2013).
We observed that point mutations in the rpsL gene occurred in strains cultured in secondary solid culture (Fig. 4). Previous studies have mainly focused on antibiotic treatment as an important factor in the development of antibiotic-resistant strains. Recently, it has been reported that these overlapping stresses increase the development of antibiotic resistance, and the development of antibiotic resistance and genetic evolution in E. coli are more strongly promoted under combined stress conditions of insecticides and streptomycin (Xing et al., 2021).
Additionally, the synergistic effect of pesticides and other antibiotics has been shown to have an effect on the selection of de novo resistant mutants, suggesting that the synergistic effect may not be limited to one antibiotic (Xing et al., 2020). In agricultural environments, various complex factors, including pesticides, contribute to the selection pressures for antibiotic resistance. Therefore, further research is needed to investigate the occurrence and genetic mechanisms of antibiotic resistance under these conditions.
The results of the study show an increased incidence of streptomycin-resistant strains at 30°C suggesting that temperature may act as an auxiliary stress factor in antibiotic use, promoting the occurrence of antibiotic-resistant strains. Our results suggest that rpsL mutations may contribute to streptomycin resistance, as target-modifying mutations in rpsL have been reported to cause strong resistance to streptomycin (Oz et al., 2014; Wistrand-Yuen et al., 2018). The rpsL gene encodes the S12 protein, a component of the 30S ribosomal subunit that is the target of streptomycin. Mutations in this gene cause bacteria to become resistant as streptomycin cannot bind to its target. The absence of strA/B genes is thought to be a result of experiments conducted using pure culture under laboratory conditions.
Effective mitigation strategies against the development and spread of strong antibiotic resistance must be established more carefully and comprehensively, taking into account the selective pressure and genetic changes of microbial populations under various environmental conditions. Overall, the presence of antibiotics and other stressors in a particular environment makes antibiotic resistance more difficult to control. In the case of temperature, it is necessary to effectively remove antibiotics at the initial stage of exposure or before entering the receiving environment, such as avoiding the time when the temperature rises in relation to pathogen occurrence. Therefore, this study suggests the need for new guidelines in the use of antibiotics by providing basic data on how environmental factors affect the development of antibiotic resistance.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was supported by Chungbuk National University National University Development Project (NUDP) program (2023).

Fig. 1
Measurement of the minimum inhibitory concentration (MIC) of Xanthomonas arboricola pv. pruni against streptomycin at 28°C. (A) MIC values measured at streptomycin concentrations ranging from 0.25 to 1,000 μg/ml. (B) MIC values measured at streptomycin concentrations ranging from 10 to 20 μg/ml. The negative control is labeled as Negative, which is a treatment group that was not inoculated with bacteria. (C) Viable cell counts were assessed at various streptomycin concentrations ranging from 0.25 to 1,000 μg/ml. The data are expressed as Log10 (cfu/ml) and represent the mean ± standard deviation of three independent replicates.
ppj-oa-08-2024-0119f1.jpg
Fig. 2
Results of minimum inhibitory concentration (MIC) measurements for streptomycin at 25 μg/ml at different temperatures. (A) MIC measurement method, with an added washing step at various temperatures. (B) MIC measured at 10°C. (C) MIC measured at 25°C. (D) MIC measured at 30°C. MIC measured at 10°C (E), 25°C (F), and 30°C (G), at streptomycin concentrations of negative, 5, 10, 15, and 20 μg/ml. Viable cell counts were expressed as Log10(cfu/ml) and are shown as mean ± standard deviation of three independent biological replicates. The negative control is labeled as negative, which is a treatment group that was not inoculated with bacteria. LB, Luria-Bertani.
ppj-oa-08-2024-0119f2.jpg
Fig. 3
Measurement of antibiotic resistance frequency at different concentrations. (A) Measurements were taken in a 96-well plate at 28°C with streptomycin concentrations of 10, 25, and 50 μg/ml. Wells that showed bacterial growth only in the liquid medium were classified as non-resistant, while those that exhibited growth in both the liquid wells and LB agar medium containing 100 μg/ml of streptomycin were classified as resistant. NC is negative control. (B) The proportion of resistance observed in the 96-well plate. (C) The proportion of growth observed in the resistance medium. (D) The ratio of non-growth to resistant.
ppj-oa-08-2024-0119f3.jpg
Fig. 4
Measurement of antibiotic resistance frequency at different temperatures. (A) Measurements were taken in a 96-well plate containing 25 μg/ml streptomycin at temperatures of 20°C, 25°C, 28°C, and 30°C. Wells that only showed growth were classified as non-growth, while those that grew in both the wells and Luria-Bertani (LB) agar medium containing 100 μg/ml of streptomycin were classified as resistant. (B) The proportion of resistance observed in the 96-well plate. (C) The proportion of growth observed in the resistance medium. (D) The ratio of non-growth to resistant.
ppj-oa-08-2024-0119f4.jpg
Fig. 5
Amplification of the strA, strB, and rpsL genes in streptomycin-resistant strains of Xanthomonas arboricola pv. pruni. (A) Agarose gel electrophoresis of PCR products amplified using the strA/strB primers, strAP-F and strAT-R, strBP-F and strBT-R, and 16S-F and 16S-R primers. Lane X represents Xanthomonas arboricola pv. pruni. Lane M is a 100 bp ladder; lanes 1-5 show no-growth strains: G9 (lane 1), B9 (lane 2), C10 (lane 3), E8 (lane 4), and B3 (lane 5); lanes 6-9 show resistant strains: C6 (lane 6), B7 (lane 7), D6 (lane 8), and F11 (lane 9). (B) Sequencing results obtained using the rpsL-F and rpsL-R primers. S is a susceptible strain; XAP1 refers to Xanthomonas arboricola pv. pruni KACC 19949; and XAP2 refers to Xanthomonas arboricola pv. pruni KACC 19949, and XAP2 referring to Xanthomonas arboricola pv. pruni strain F1 107. ‘SR’ refers to wells that showed no growth in the 96-well plate (non-growth), while RR indicates resistant wells that showed growth in both the 96-well plate and resistance medium. The * symbol indicates a mutated nucleotide sequence.
ppj-oa-08-2024-0119f5.jpg
Table 1
Primers used in this study
Primer 5′-Oligo Seq-3′ Size (bp) Reference
strAP-F TCATCAGAAAACTGAAGG AACCTC 938 Herbert et al. (2022)
strAT-R GAGTCCCGTCTGGCAATGAAA Herbert et al. (2022)
strBP-F TTTCCTGCTCATTGGCACGTTT 909 Herbert et al. (2022)
strBT-R GAGGGCGAAATCCTACGCTA Herbert et al. (2022)
rpsL-F TTAGCTCTTCGGGCGCTT 375 This study
rpsL-R ATGACGACGATCAATCAGCTG This study
16S-F TGCACGAAAGCGTGGGGAGC 188 Bocsanczy et al. (2012)
16S-R CATCCACCGCTTGTGCGGGT Bocsanczy et al. (2012)

References

Andersson, D. I. and Hughes, D. 2014. Microbiological effects of sublethal levels of antibiotics. Nat. Rev. Microbiol. 12:465-478.
crossref pmid pdf
Bocsanczy, A. M., Achenbach, U. C. M., Mangravita-Novo, A., Yuen, J. M. F. and Norman, D. J. 2012. Comparative effect of low temperature on virulence and twitching motility of Ralstonia solanacearum strains present in Florida. Phytopathology 102:185-194.
crossref pmid
Cameron, A. and Sarojini, V. 2014. Pseudomonas syringae pv. actinidiae: chemical control, resistance mechanisms and possible alternatives. Plant Pathol. 63:1-11.
crossref
Cohen, S. P. and Leach, J. E. 2020. High temperature-induced plant disease susceptibility: more than the sum of its parts. Curr. Opin. Plant Biol. 56:235-241.
crossref pmid
Cruz-Loya, M., Kang, T. M., Lozano, N. A., Watanabe, R., Tekin, E., Damoiseaux, R., Savage, V. M. and Yeh, P. J. 2019. Stressor interaction networks suggest antibiotic resistance co-opted from stress responses to temperature. ISME J. 13:12-23.
crossref pmid pmc pdf
Fischer-Le Saux, M., Bonneau, S., Essakhi, S., Manceau, C. and Jacques, M.-A. 2015. Aggressive emerging pathovars of Xanthomonas arboricola represent widespread epidemic clones distinct from poorly pathogenic strains, as revealed by multilocus sequence typing. Appl. Environ. Microbiol. 81:4651-4668.
crossref pmid pmc pdf
Garita-Cambronero, J., Palacio-Bielsa, A. and Cubero, J. 2018. Xanthomonas arboricola pv. pruni, causal agent of bacterial spot of stone fruits and almond: its genomic and phenotypic characteristics in the X. arboricola species context. Mol. Plant Pathol. 19:2053-2065.
crossref pmid pmc pdf
Goltermann, L., Good, L. and Bentin, T. 2013. Chaperonins fight aminoglycoside-induced protein misfolding and promote short-term tolerance in Escherichia coli. J. Biol. 288:10483010489.
crossref pmid pmc
Herbert, A., Hancock, C. N., Cox, B., Schnabel, G., Moreno, D., Carvalho, R., Jones, J., Paret, M., Geng, X. and Wang, H. 2022. Oxytetracycline and streptomycin resistance genes in Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot in peach. Front. Microbiol. 13:821808.
crossref pmid pmc
Kohanski, M. A., Dwyer, D. J., Wierzbowski, J., Cottarel, G. and Collins, J. J. 2008. Mistranslation of membrane proteins and two-component system activation trigger antibiotic-mediated cell death. Cell 135:679-690.
crossref pmid pmc
Lamichhane, J. R. and Varvaro, L. 2014. Xanthomonas arboricola disease of hazelnut: current status and future perspectives for its management. Plant Pathol. 63:243-254.
Lyu, Q., Bai, K., Kan, Y., Jiang, N., Thapa, S. P., Coaker, G., Li, J. and Luo, L. 2019. Variation in streptomycin resistance mechanisms in Clavibacter michiganensis. Phytopathology 109:1849-1858.
crossref pmid
McManus, P. S., Stockwell, V. O., Sundin, G. W. and Jones, A. L. 2002. Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40:443-465.
crossref pmid
Miller, S. A., Ferreira, J. P. and LeJeune, J. T. 2022. Antimicrobial use and resistance in plant agriculture: a one health perspective. Agriculture 12:289.
crossref
Mindlin, S. Z. and Petrova, M. A. 2017. On the origin and distribution of antibiotic resistance: permafrost bacteria studies. Mol. Genet. Microbiol. Virol. 32:169-179.
crossref pdf
Newbery, F., Qi, A. and Fitt, B. D. L. 2016. Modelling impacts of climate change on arable crop diseases: progress, challenges and applications. Curr. Opin. Plant Biol. 32:101-109.
crossref pmid
Oz, T., Guvenek, A., Yildiz, S., Karaboga, E., Tamer, Y. T., Mumcuyan, N., Ozan, V. B., Senturk, G. H., Cokol, M., Yeh, P. and Toprak, E. 2014. Strength of selection pressure is an important parameter contributing to the complexity of antibiotic resistance evolution. Mol. Biol. Evol. 31:2387-2401.
crossref pmid pmc
Palacio-Bielsa, A., Roselló, M., Cambra, M. A. and López, M. M. 2010. First report on almond in Europe of bacterial spot disease of stone fruits caused by Xanthomonas arboricola pv. pruni. Plant Dis. 94:786.
Rodríguez-Verdugo, A., Lozano-Huntelman, N., Cruz-Loya, M., Savage, V. and Yeh, P. 2020. Compounding effects of climate warming and antibiotic resistance. iScience 23:101024.
crossref pmid pmc
Roselló, M., Santiago, R., Palacio-Bielsa, A., García-Figueres, F., Montón, C., Cambra, M. A. and López, M. M. 2012. Current status of bacterial spot of stone fruits and almond caused by Xanthomonas arboricola pv. pruni in Spain. J. Plant Pathol. 94(1 Suppl):15-21.
Stefani, E. 2010. Economic significance and control of bacterial spot/canker of stone fruits caused by Xanthomonas arboricola pvpruni. J. Plant Pathol. 92(1 Suppl):99-103.
Sundin, G. W. and Wang, N. 2018. Antibiotic resistance in plant-pathogenic bacteria. Annu. Rev. Phytopathol. 56:161-180.
crossref pmid
Tancos, K. A. and Cox, K. D. 2017. Effects of consecutive streptomycin and kasugamycin applications on epiphytic bacteria in the apple phyllosphere. Plant Dis. 101:158-164.
crossref pmid
van Overbeek, L. S., Wellington, E. M. H., Egan, S., Smalla, K., Heuer, H., Collard, J.-M., Guillaume, G., Karagouni, A. D., Nikolakopoulou, T. L. and van Elsas, J. D. 2002. Prevalence of streptomycin-resistance genes in bacterial populations in European habitats. FEMS Microbiol. Ecol. 42:277-288.
crossref pmid
VanBogelen, R. A. and Neidhardt, F. C. 1990. Ribosomes as sensors of heat and cold shock in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 87:5589-5593.
crossref pmid pmc
Velásquez, A. C., Castroverde, C. D. M. and He, S. Y. 2018. Plant-pathogen warfare under changing climate conditions. Curr. Biol. 28:R619-R634.
crossref pmid pmc
Verhaegen, M., Bergot, T., Liebana, E., Stancanelli, G., Streissl, F., Mingeot-Leclercq, M.-P., Mahillon, J. and Bragard, C. 2023. On the use of antibiotics to control plant pathogenic bacteria: a genetic and genomic perspective. Front. Microbiol. 14:1221478.
crossref pmid pmc
Wistrand-Yuen, E., Knopp, M., Hjort, K., Koskiniemi, S., Berg, O. G. and Andersson, D. I. 2018. Evolution of high-level resistance during low-level antibiotic exposure. Nat. Commun. 9:1599.
crossref pdf
Xing, Y., Kang, X., Zhang, S. and Men, Y. 2021. Specific phenotypic, genomic, and fitness evolutionary trajectories toward streptomycin resistance induced by pesticide co-stressors in Escherichia coli. ISME Commun. 1:39.
crossref pdf
Xing, Y., Wu, S. and Men, Y. 2020. Exposure to environmental level pesticides stimulates and diversifies evolution in Escherichia coli towards greater antibiotic resistance. Environ. Sci. Technol. 54:8770-8778.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next