Plant Pathol J > Volume 41(2); 2025 > Article
Clement, Kalpana, Aiyanathan, Ramakrishnan, Kandan, Manonmani, Yesuraja, Sabarinathan, Mini, Shanthi, Rajangam, and Punitha: Exploring the Perilous Nature of Phytophthora: Insights into Its Biology, Host Range, Detection, and Integrated Management Strategies in the Fields of Spices and Plantation Crops

Abstract

The horticultural crops, including spices and plantation crops, are known for their enormous benefits, contributing to the country’s economy. However, Phytophthora, a genus of Oomycetes class, poses a threat to spice and plantation crops by infecting and damaging them, resulting in yield losses, economic hardship for farmers, and food security concerns, thereby threatening the sustainability of spice and plantation crops. Moreover, Phytophthora has greater adaptation systems in varying environmental conditions. Therefore, eradicating or controlling Phytophthora is a highly challenging process due to the longevity of its infective propagules in soil. Early detection and curative measures would be more effective in managing this destructive pathogen. Additionally, molecular detection using innovative methods such as polymerase chain reaction, reverse transcription polymerase chain reaction, recombinase polymerase amplification, and loop-mediated isothermal amplification would offer reliable and rapid detection. Furthermore, integrated disease management strategies, combining cultural, physical, chemical, and biological methods, would prove highly beneficial in managing Phytophthora infections in spices and plantation crops. This review provides a comprehensive overview of the diversity, symptomatology, pathogenicity, and impact of Phytophthora diseases on prominent spice and plantation crops. Finally, our review explores the current disease reduction strategies and suggests future research directions to address the threat posed by Phytophthora to spices and plantation crops.

The spices and plantation crops have long been recognized for their enduring benefits over centuries. Spices were esteemed as some of the most valuable trade items in the ancient and medieval world (Vasanthi and Parameswari, 2010). The global spice production stands at around 13.1 million tonnes. In addition to spices, plantation crops play a pivotal role in soil conservation, ecosystem preservation, and employment generation within the agriculture sector (Chowdappa et al., 2014). According to estimates from 2022-2023, the total production of plantation crops in India alone is expected to be around 16.05 million tonnes (Ministry of Agriculture and Farmers Welfare, 2022-2023). However, significant concerns surrounding these crops include high production costs, small-scale cultivation, poor quality standards, and competition for land (Herath, 2002).
The spices and plantation crops encounter various biotic and abiotic stresses (Vinod, 2011). These crops are susceptible to a range of fungal, bacterial, and viral diseases, leading to significant reductions in yield. Major spice crop diseases include wilt, root rot, blight, mildew, and leaf spots. In contrast, plantation crops are impacted by rot diseases, causing substantial declines in crop production and yield. Phytophthora species have become a significant concern among the major fungal diseases affecting spice and plantation crops due to their highly destructive impact. Based on epidemiological prowess and virulence, Phytophthora species is considered one of the most destructive genera in temperate and tropical regions, causing annual damages in billions (Drenth and Guest, 2004).
The Phytophthora genus is known to infect a variety of spices and plantation crops. The Phytophthora taxonomy has undergone many evolutions during the study. Based on nuclear and mitochondrial characteristics, 12 well defined clades have been recognized till now (Brasier et al., 2022). The twelve-clade internal transcribed spacer (ITS) phylogeny is a phylogenetic tree constructed based on sequence data from the ITS region. This framework provides a structured way to classify and understand the diversity within the genus. An abundance of Phytophthora species is noticed in forest soils, streams, and canopies. Still, more natural ecosystems and new species are yet to be described (Hansen et al., 2012).
The emergence of new genotypes and global migration has increased the risk of spreading Phytophthora species. Interspecific hybridizations have a remarkable impact on the genome characteristics of this oomycete pathogen. These genera do not seem to synthesize sterols, which makes the fungicidal treatments ineffective (Avila-Quezada and Rai, 2023). According to global data, the notorious Phytophthora species remain significant obstacles to horticulture forestry and agriculture (Abad et al., 2023), leading to substantial yield losses. Detailed information about different Phytophthora species infecting major spices and plantation crops is unavailable. Therefore, the main aim of this review is to understand the nature, biology, geographical distribution, host range, symptomology, and complexity of the perilous pathogen, their timely detection using advanced molecular tools, and also the integrated disease management (IDM) strategies to combat the awful phytopathogen-Phytophthora infecting spices and plantation crops.

Phytophthora-as Soilborne Pathogen and Its Disease Cycle

Phytophthora, a member of the oomycete, is considered a threat which has revisited the 21st century (Guha Roy, 2015). It is considered the world’s most historic and economically significant genus in plant pathology. Phytophthora members, are considered severe threats to agriculture as well as horticulture causing diseases in hundreds of crops. Similarly, the spices and plantation crops are highly susceptible to this genus, which remains persistent for many years. The first Phytophthora species identified was Phytophthora infestans (De Bary, 1876)—the pathogen responsible for late blight in potatoes, having a significant history dating back to the mid-19th century when it caused the Great Irish Famine in 1845. The impact of the epidemic was so catastrophic and sound. This famine, on average, killed more than one million people (Turner, 2005). Till today, the late blight of potatoes remains a destructive disease leading to an annual loss of potatoes. Likewise, Phytophthora spp. remain a persisting pathogen in the fields of spices and plantation crops extending its damage at greater levels. Some common pathogenic effects of Phytophthora are leaf blights, collar rot, root rot, stem canker, and fruit rots. This genus consists of both necrotrophic and biotrophic species parasitizing a wide range of host plants, substantially leading to losses in millions worldwide. Phytophthora, also known as the “Plant Destroyer,” has more than 200 identified species, with additional species being identified each year.
The soil serves as a favorable habitat for various microorganisms, including fungi, bacteria, viruses, algae, and protozoa (Lucas, 2006). The ability of some microorganisms to infect plants are so-called soilborne pathogens, and they tend to complete their entire life cycle in soil or a part of their life cycle in the aerial parts. According to the research studies and economic impact, soilborne pathogens seem to affect crops worldwide, and their control is quite complex (Lucas and Sarniguet, 1998). Since the spice and plantation crops are perennial in nature, the pathogen survives as resting spores in the soil for many years serving as primary source of inoculum causing infections when the environmental conditions favor.
Successful disease establishment of these pathogens occurs only after the completion of the disease cycle. For an infection to be successful, first, the pathogen makes contact with the plant and gets itself attached to the surface of the host. This is followed by penetration, wherein the nutrients required for efficient growth and sporulation are driven (Hardham, 2001). The disease cycle occurs viz. the following stages: (1) Initial contact with the host, (2) Encystment of the zoospore and plant surface adhesion, (3) Spore germination and penetration into the host, (4) Colonization of the host plant, (5) Nutrient acquisition from the host, and (6) Sporulation.

Systematic Position and Classification - Phytophthora species

The water moulds Phytophthora though tend to resemble the members of fungi, they are placed in the Kingdom Chromista and the Phylum Oomycota (Beakes and Sekimoto, 2009). The genus Phytophthora has been widely acknowledged as taxonomically ‘difficult’ (Brasier, 1983), as many of the characters used for species identification are plastic, highly influenced by the environment, show overlap between species, and have an unknown genetic basis. The higher classification levels have led to the placement of this genus in the order Perenosporales, class Perenosporomycete, and the family Perenosporaceae (Abad et al., 2023). Phytophthora classification was based on morphology (Waterhouse, 1963). Advancements in DNA sequencing paved the way for the classification based on molecular phylogeny. Later, the progress made by Cooke et al. (2000) led to the first molecular phylogenic classification of 51 species, wholly based on the sequences of ITS regions placed into eight well defined clades (Clade 1 to 8) followed by two potentially distant clades (Clade 9 and 10).
Further evolutions led to species classification based on the nuclear and mitochondrial genes (Kroon et al., 2004). Later, Blair et al. (2008) made phylogenetic sequences based on seven genetic markers. Rahman et al. (2015) paved way for the addition of eleventh clade (Clade 11) which was followed by Jung et al. (2017) who proposed the addition of the twelfth clade (Clade 12) using multigene phylogeny.
Bourret et al. (2018) proposed some additional clades from 13 to 16, where the provisional Phytophthora species has been placed in these clades. At present, the genus Phytophthora comprises a total of 266 described species spread across 17 phylogenetic clades with additional clades under the inclusion process (Abad et al., 2023).

Pathogen Biology and Life Cycle

Phytophthora is primarily soil and water-inhabiting oomycetes and exhibits a range of pathogenic natures, from hemi-biotrophic to necrotrophic, forming zoosporic sporangia. Phytophthora species are distinguishable from the higher fungi, through distinct features, like the occurrence of coenocytic hyphae with subtle constrictions at the base of their branches forming right angles (Brasier et al., 2022). Additionally, they produce sporangiophores containing laterally biflagellate zoospores enclosed within the sporangium (Ho, 2018). Furthermore, the genus is characterized by a spherical oospore with a limited periplasm in the globose oogonium.
Phytophthora species can exhibit either homothallic characteristics, producing abundant sexual organs within single cultures, or heterothallic traits, necessitating pairing in dual cultures with compatible A1 or A2 mating types. The oospore is typically spherical and hyaline, although it may sometimes appear yellowish. Usually, only one antheridium is present per oogonium, and the presence of the amphigynous antheridium remains a distinct and unique feature of Phytophthora in the monotypic genus (Tabor and Bunting, 1923).
Most Phytophthora spores are asexual spores with specialized hyphae known as the sporangiophores. They are branched and bear many numbers of multinucleate spores called sporangia or zoosporangia (Bartnicki-Garcia and Wang, 1983). The sporangia have a distinct ability to germinate using two different pathways via direct and indirect germination (Situ et al., 2022). Higher temperatures favor direct germination, where hyphae formation occurs through the sporangial wall (Judelson and Blanco, 2005). Indirect germination is highly favored in cooler temperatures. Environmental conditions play a crucial role in the survival and spread of Phytophthora species in the spice and plantation crop fields. The continuous wet, humid and damp conditions facilitate rapid movement of zoospores, increasing plant susceptibility, while also enhancing the pathogen’s ability to survive as resting spores in soil for many years under unfavourable conditions.
Further colonization in the host plants takes place through the help of natural openings. The escape of wall less zoospores take place as a result of the dissolution of the sporangium. The zoospores freed by the turgor pressure (Ambikapathy et al., 2002) continue to swim and locate themselves near the host tissues through various mechanisms. Both homothallic and heterothallic mating systems are noticed in the oomycetes. The thick-walled oospore peculiar to Oomycetes helps in sexual reproduction. The sexual cycle is initiated by forming both male and female gametangia (Fabritius et al., 2002), and antheridium makes pairing. This results in synchronous meiosis wherein the fertilization tube is developed between the antheridium and oogonium, and then a single haploid nucleus is transferred from the male to the female. The oospore’s maturation results in a multi-layered thick wall, making it an effective resting structure (Judelson, 2009). The schematic representation of the life cycle of Phytophthora species infecting spice and plantation crop is depicted in Fig. 1.

Host Range of Phytophthora Species

Phytophthora species show more significant variations in their degrees of host specificity (Drenth and Sendall, 2001). They seem to have a broader host range, causing remarkable damage to crop hosts worldwide. For example, Phytophthora fragariae var. rubi attacks only one host, whereas P. cinnamomi can infect as many as 1,000 hosts at varying adaptations (Erwin and Ribeiro, 1996). Some Phytophthora species attack the broad host range using certain enzymes (Brasier, 1983). In contrast, some host-specific species interact specifically in a gene-for-gene system with the host’s resistance genes. Since the genus is widespread globally, it affects almost all crops worldwide, including spices and plantation crops. Table 1 shows the list of Phytophthora species with their broad host range and geographical distribution.

Symptomology and Impact of Phytophthora on Spices and Plantation Crops

Phytophthora species produce a variety of symptoms depending upon their virulence and environmental conditions. Some common symptoms of Phytophthora species include root rot, collar rot, tree cankers, leaf blight, tuber and corm rot, bud rot, and fruit rot (Drenth and Sendall, 2001). They also tend to pose various below and aboveground symptoms, such as rotting of feeder roots, which results in blackening and decay, and some aboveground symptoms, such as pale green leaves, wilting, dieback of shoots, etc. The spices and plantations are highly targeted by Phytophthora species, mainly during the monsoon seasons causing severe disasters. Phytophthora infections remain a persistent threat to the spice and plantation crops, causing yield losses from 10-100%, leading to severe economic imbalance and impacting the global market system. This genus represents a diverse group of plant pathogens that epitomize global biosecurity issues (Scott et al., 2019).
The various symptoms produced, and the damages caused by Phytophthora species in various spice and plantation crops along with their yield losses have been tabulated (Table 2).

Molecular Detection and Characterization

Phytophthora activity may vary widely depending on environmental conditions or the availability of host systems, ranging from dormancy to rapid increases in density over a short period. Therefore, a more rapid and sensitive method would ensure timely detection and management. Over the last 15 years, DNA sequence analysis has significantly advanced our comprehension of the diversity and phylogenetic relationships within the Phytophthora genus. Molecular diagnostics are widely used for faster and more precise species identification. In order to ensure the exact identification of Phytophthora species, various DNA-based identification methods have been explored (Kroon et al., 2012). Nucleic acid-based tools are more sensitive, rapid, and reliable for detecting Phytophthora in some essential crops (Cissin et al., 2016; O’Brien et al., 2009) both at the genus and species levels. Various molecular methods were emphasized for successfully detecting and identifying Phytophthora species. These methods include protein electrophoresis, determination of isozyme pattern, Direct sequencing of ITS, and polymerase chain reaction (PCR)-based fingerprinting.
For example, the PCR has been a significant molecular taxonomy and detection breakthrough. The advantages of PCR lie in its high specificity, sensitivity, and rapidity compared to traditional methods. PCR has been widely used for the detection of fungal plant pathogens based on the ITS regions of ribosomal DNA (rDNA) (Grote et al., 2002; Willits and Sherwood, 1999). Conventional and closed tube nested PCR was more effective for detecting and identifying Phytophthora at the species level. Grote et al. (2002) highlighted the usage of nested PCR as it enables the detection of the pathogen at lower levels and can also be used as a warning tool for the detection and diagnosis at earlier stages. Real-time PCR has the potential to quantify target DNA (Livak and Schmittgen, 2001) accurately. This method proved efficient as it could sense the quality of the DNA within a short span and help produce disease-free plantlets (Huang et al., 2010). Some studies have shown that endonuclease restriction analysis of ITS-restriction fragment length polymorphism (ITS-RFLP) and amplified fragment length polymorphism possess higher levels of resolving power for distinguishing between and within species (O’Neil et al., 1997). A novel and new assay named recombinase polymerase amplification (RPA) performed under isothermal conditions had more significant advantages, including minimal assay time. RPA assays specific to the Phytophthora genus were developed by Miles et al. (2015), and the detection limit was found to be 200 to 300 fg. Loop-mediated isothermal amplification (LAMP) is an emerging technique for detecting plant pathogens with higher levels of accuracy using species-specific primers. LAMP is widely known for its low resource utilization and sensitivity (Notomi et al., 2000) (Table 3). Portraying the novel molecular tools used for the detection of Phytophthora species in a wide array of spices and plantation crops is given below.

Management Strategies to Combat Phytophthora

Phytophthora, a dreadful pathogen, needs a combination of management strategies to avoid crop damage and yield loss. Understanding pathogens’ genomic makeup, virulence factors, and epidemiology forms the groundwork for crafting tailored approaches to combat biotic diseases in spices and plantation crops (Scortichini, 2022). IDM, which holistically combines cultural, physical, chemical, and biological control strategies rather than using a single component, was more effective and sustainable (Khoury and Makkouk, 2010). This section provides the current approaches for Phytophthora management, including cultural, chemical, genetic, and biological control.

Cultural management

The cultural control method would be the only economically viable method for some crops in the developing country (Khoury and Makkouk, 2010). In order to reduce the incidence of P. capsici in chili, cultural practices such as raised beds, mulching, proper irrigation management, and moisture-based forecasting models would ensure reductions in the severity of the disease (Sanogo and Ji, 2013). In black pepper, phytosanitary measures would help reduce the primary inoculum and manage the foot rot disease. Shade regulation can be done to reduce humidity. The vines infected by foot rot symptoms will be uprooted and burnt earlier. Crop rotation with non-host species can be adopted to manage the field’s oospores (Babadoost, 2016). Adequate cultural practices favoring the plant and disfavoring the pathogen help reduce the disease severity. According to Granke et al. (2012), a slight angle of inclination of the beds in the rainy season is recommended for proper drainage. Khan et al. (2020) suggested phytosanitary measures such as removing and destroying affected parts and wound dressing with tar to manage the infection. Good drainage is the prime factor in minimizing Phytophthora in cinnamon crops. In oil palms, proper drainage and avoidance of overhead irrigation have reduced P. palmivora infections (Martínez, 2009). Covering the bunches with polythene effectively prevented foot rot disease in areca nut. Covering the bunches before the monsoon resulted in 100% control of this disease (Chowdappa et al., 2000). For the effective management of Phytophthora infection in cocoa plantations, cultural practices such as nutrient management, canopy pruning, and field hygiene were found to be highly successful (Peter and Chandramohan, 2014). As wet weather and excess moisture favor pathogen availability, ensuring adequate drainage prevents soil inoculum build-up. The selection of fields with low pathogen inoculum and good drainage is the first line of defense against this pathogen. Before chemical control methods, phytosanitary measures such as removing decayed materials, thinning, pruning, etc., were more efficacious in managing Phytophthora diseases.

Genetic control

Genetic resistance holds a pivotal role in plant disease management. Most cellular pathogens, such as fungi, bacteria, and oomycetes, use the effector and toxin proteins to enter the cytoplasm. In the case of oomycetes, they tend to enter the host cells directly (Tyler, 2011). P. capsici, being a pathogen with a broad host range, has developed resistance over time. Saltos et al. (2022) interpreted that some genotypes, such as Nathalie, ECU 12831, ECU 9129, and ECU 1296, showed effective resistance against root and crown rot diseases. Race-specific resistance (Sy et al., 2008) and Syndrome-specific resistance (Sy et al., 2005) has been reported in chili peppers. Using recurrent selection, has ensured polygenic resistance in the elite materials (Thabuis et al., 2004). Reeves et al. (2013) recognized a resistance gene (Ipcr) inhibiting P. capsici. Grafting was evident in conferring genetic resistance (Gisbert et al., 2010). Jang et al. (2012) reported that grafted pepper plants significantly resisted P. capsici and R. solanacearum. In chili crops, the genotypes were evaluated for resistance against P. capsici, which causes root rot. The evaluation concluded that a significant dominant gene associated with a few minor gene-controlled resistance. The genotype IHR 3575 was resistant against the virulent isolate PC-IIHR1 (Kumar et al., 2021). Mohammadbagheri et al. (2022) stated that, in characterizing the resistance for root and crown rot, the five new genotypes such as 11BlockyP-YToran, 19OrnP-PBI, 23CherryP-Orsh, 32OrnP-China, and 37ChilP-Paleo were found resistant against P. capsici. In Capsicum annum, 45 physiological races showing resistance using different R genes against Phytophthora root rot and blight were reported. McGregor et al. (2011) reported the various sources of resistance, such as Criollo de Morelos 334 (CM334), PI 201232, PI 201234, PI 201237, and PI 640532 from Mexico, followed by AC2258 from Central America, and perennial from India showing resistance to P. capsici. Piper colubrinum, a wild species of black pepper, was found resistant to P. capsici, causing rot diseases. The resistance is due to the hypersensitive response on recognition of the entry of the pathogen (Suraby et al., 2020).
Rachana et al. (2024) elucidated the use of coconut resistant gene analogues (CnRGAs) in formulating resistant breeding strategies against P. palmivora which causes bud rot in coconut. Cooley et al. (2000) identified the gene RPP8 to exhibit resistance against P. parasitica.
Similarly, the stacking of three resistant gene’s namely RB, Rpi-blb2, and Rpi-vnt1.1 proved highly successful in managing the late bight of potatoes which showed extreme resistance (Ghislain et al., 2019). The R genes including R1, R2, R3a, and R3b identified from the wild species of S.demissum exhibited race-specific resistance, aiding in the management of late blight disease in potato crops (Kim et al., 2012). The R8 gene found in the transgenic potatoes also tend to exhibit a broad spectral activity against P. infestans enabling long-term resistance (Jiang et al., 2018).
Similarily, The Rps11 gene provides resistance against P. sojae, serving as a promising source of resistance ensuring improved production and protection of soybean (Ping et al., 2016). The novelty of three resistance genes, namely Rps3a, Rps 3c, and Rps 4 was found to be effective in managing Phytophthora root rot in soybean crop (McCoy et al., 2022). So far, 33 Rps genes have been discovered in different soybean cultivars (Zhong et al., 2019) showing evident results in the management of Phytophthora root rot. Lucas (1975), reported the R genes Php and PhI to confer complete resistance to P. nicotianae otherwise known as race 0. Similarly, Drake et al. (2015) found the Wz gene to be highly effective in managing black shank disease caused by P. nicotianae. Mapping studies revealed the quantitative trait loci (QTL) Phn 7.1 to confer partial resistance against P.nicotianae. Future developments by combining both Ph and Wz genes in the genetic backgrounds could ensure slow adaptation to the pathogen, thereby contributing to improved cultivars, that are highly effective against black shank disease (Jin et al., 2022).
The resistance to black pod disease is primely oligogenic, and the genotypes of the F1 generation (TSH 1188 9 × CCN 51) could ensure increased resistance to black pod disease in future breeding programs (Barreto et al., 2015). Mucherino Muñoz et al. (2021) identified 20 QTL involved in resistance against Phytophthora species and suggested the involvement of the candidate genes 164 from CRIOLLO genome and 160 from the MATINA genome in the recognition and activation of defense responses. Baruah et al. (2024) studied the seven genotypes for their resistance to P. palmivora where the genotypes CCN51, Sca6, and Pound 7 exhibited resistance post-penetration which would ensure better management strategies against black pod rot disease of cocoa.
Apart from this, the usage of enzymes such as cellulose synthase 1, ATPases, mitogen-activated protein kinases, and Nep-1-like proteins, which tend to play an essential role in Phytophthora metabolism, can be employed for managing the pathogenesis of Phytophthora (Avila-Quezada and Rai, 2023).

Chemical management

For decades, fungicides have been essential in controlling plant diseases (Khoury and Makkouk, 2010). Chemicals are widely recommended for Phytophthora control, but their effectiveness varies depending on the incidence and severity, particularly during high-disease pressure in the wet season. At weekly intervals, copper-based fungicides and systemic fungicides such as metalaxyl are recommended for managing Phytophthora diseases. In black pepper, nursery treatment by spraying either with 1% Bordeaux mixture and soil drenching with 0.2% copper oxychloride or spray cum drenching with metalaxyl-mancozeb 0.125% or a spray with potassium phosphonate 0.3% at timely intervals is highly recommended to avoid the incidence and spread of Phytophthora species (Anandraj and Susheela Bhai, 2015; Kumar et al., 2012). For managing Phytophthora in cardamom through chemical means, spraying with 1% Bordeaux mixture or drenching with 0.2% copper oxychloride effectively destroyed the soil inoculum. Also, other chemicals like Fosetyl-aluminium 0.2% or potassium phosphonate can be sprayed @ 500-750 ml/clump. For effective management of Phytophthora species in Vanilla, spraying with 1% Bordeaux mixture and soil drenching with 0.25% copper oxychloride can be employed, depending on the disease severity. Spraying potassium phosphonate 0.4% was also effective in reducing the disease incidence. In tree species, spraying with 1% Bordeaux mixture before the onset of monsoon season effectively prevents disease development. The fungicidal application was found to be a prophylactic measure for managing Phytophthora diseases (Anandaraj and Suseela Bhai, 2015). Spraying of Bordeaux mixture (1%) and removing fallen nuts reduced the incidence of Phytophthora in areca nut. Naik et al. (2019) also found that applying a 1% Bordeaux mixture before the onset of monsoon drastically reduced the Koelroga disease in areca nut plantations. Sagaff et al. (2022) reported that using copper oxychloride mixed with mineral oil reduced the severity of abnormal leaf fall disease in rubber.
The application of fungicides had a better impact when used within an IDM strategy. New generation fungicides were eco-friendly, with minimal doses compared to conventional fungicides. Some of the new generation fungicides such as famoxadone, fenamidone, fluopicolide, zoxamide, iprovalicarb, benthiavalicarb, mandipropamid cyazofamid, and ethaboxam were found effective in managing Phytophthora species and other related oomycetes through various modes of action (Thind, 2009). Fluopicolide is a recently developed acyl picolide fungicide with a unique mode of action that is highly effective against a wide range of oomycetes. The study by (Shin et al., 2010) showed evident results in managing Phytophthora blight in pepper as fluopicolide served as a potent inhibitor of mycelial growth, zoospore release, and germination. Rini and Remya (2020) found that the new generation fungicide fenamidone 10WDG, along with mancozeb, resulted in the management of P. capsici in black pepper. Patil et al. (2023) evaluated the new generation fungicides against P. meadii in areca nut and concluded mandipropamid as an alternative control measure for fruit rot disease.

Biological management

Phytophthora species infection poses considerable challenges to spice and plantation crop production globally. Traditional disease mitigation strategies, which often depend on chemical fungicides, are increasingly unsustainable due to environmental concerns and the development of resistance by pathogenic isolates. The alternative approach is to explore the effect of fungal and bacterial antagonists, which opens an avenue for Phytophthora management. Management of diseases using biological control agents (BCAs) seems to come from a combination of mechanisms, which includes the production of enzymes and antibiotics that play crucial roles in impeding the growth and progression of plant pathogens (Kumar et al., 2019). BCAs can suppress diseases in an eco-friendly and more sustainable manner (Yuliar et al., 2015). BCAs employ either direct or indirect methods to combat pathogenic organisms. Direct mechanisms involve actions like parasitism, antibiosis, or competition, while indirect mechanisms include inducing systemic resistance (Raymaekers et al., 2020). Biological control of plant diseases has evolved as a natural method of pathogen control by using beneficial microbes for sustainable crop production and protection (Avila-Quezada and Rai, 2023).

Fungal antagonists

The usage of fungal BCAs has rapidly increased as they have higher reproductive rates and are more target-specific. They can survive as saprophytes in the absence of host plants (Thambugala et al., 2020). Among the fungal BCAs identified so far, Trichoderma species appears to be one of the effective BCAs as it has a broader range of action to the soil and foliar pathogens. Trichoderma is found to be a potent BCA as it uses complex modes of action such as parasitism, competition, production of antibiotics, and hyper-parasitism to combat pathogenic organisms (Mukhopadhyay and Kumar, 2020).
In black pepper, the fungal BCAs such as Trichoderma species and arbuscular mycorrhizal fungi were effective against foot rot disease. Vithya et al. (2018) reported that the CKT isolate of T. harzianum is a promising BCA-suppressing foot rot incidence. The secondary metabolites of the Trichoderma species inhibit the growth of pathogens. Coffee husk-based Trichoderma formulations have been reported effective in managing the foot rot of pepper. In betel vines, the combined applications of T. harzianum mixed with 500 kg oil cake applied at quarterly intervals were found effective against Phytophthora infection, and minimum incidence was observed (Dasgupta et al., 2011).
The native species of Trichoderma, such as T. harzianum and T. hamatum, exhibited greater antagonism against Phytophthora (de Ita et al., 2021). It was also reported that four isolates of Trichoderma species demonstrated antifungal activity and reduced the mycelial growth of the pathogen. In nutmeg crops, soil application of Trichoderma was practical (Sumbula and Mathew, 2015). The application of T. harzianum pellets @ a dosage of 2 g/100 ml suspension effectively inhibited the growth of Phytophthora in cocoa seedlings (Sriwati et al., 2019). The delayed occurrence and prevention were noticed in the cocoa plants by applying Trichoderma species. In areca nut, three native species of Trichoderma effectively controlled P. meadii under in vitro conditions. Among the species tested, T. virens showed maximum inhibition at 62.5%. The bioactive compounds from A. flavipes showed potent inhibitory activity against several species of Phytophthora (El-Sayed and Ali, 2020).

Bacterial antagonists

Bacteria play a pivotal role in the management of Phytophthora (Avila-Quezada and Rai, 2023). Bacterial BCAs have gained importance as they are effective against various fungal and bacterial pathogens that cause damage to crops worldwide. The bacterial BCAs use various modes of action, which can be classified into direct and indirect, to suppress the growth of pathogens. The bacterial BCAs use different mechanisms such as antibiosis, siderophore production, competition for space and nutrition, parasitism, biofilm formation, and induction of host resistance to combat the fungal and bacterial pathogens (Haidar et al., 2016). The volatile organic compounds produced by the bacterial agents play significant roles in host plant interactions (De Vrieze et al., 2015). For example, the bacterial strains NH7, NH27, NH32 and NH46 identified as Enterobacter cloacae, Streptomyces flaveus, Klebsiella pneumoniae, and Bacillus amyloliquefaciens exhibited strong antagonistic activity against P. capsici along with the production of chitinolytic enzymes aiding in successful disease management (Nguyen et al., 2022).
In chili crop, the rhizosphere organisms was isolated and tested for their antagonism. Among the 15 isolates obtained, eight were found to be potential. The strains were tested under greenhouse conditions, showing significant disease suppression against P. capsici with increased plant growth characteristics (Hyder et al., 2020). In pepper, the bacterial isolates obtained from the rhizosphere, phyllosphere, and endosphere showed maximum ability to reduce the disease severity. The biocontrol efficacy tested ranged from 0.7% to 92.3%. The bacterial BCA, such as Bacillus cereus and Chrysobacterium species, helped manage Phytophthora blight (Yang et al., 2012). Trihn et al. (2019) screened the bacterial BCA, Bacillus velezensis RB.DS29 to exhibit strong antifungal activities against Phytophthora along with plant growth promotion in black pepper. Similarly, the bacterial agents including B. cereus, B. polymyxa, and B.licheniformis emerged as potential BCAs in managing P. meadii causing fruit rot of arecanut (Shalini and Rajashekhar, 2006). In cardamom, the two bacterial strains Pseudomonas fluorescens (Pf 51) and Bacillus subtilis (Bs) showed more significant levels of inhibition, such as 40.2% and 39.7% against P. meadii (Sivakumar et al., 2015) also reported the compatible nature of P. fluorescens and B. subtilis and concluded the effectiveness in disease suppression.
Latha et al. (2023) emphasized that soil and crown applications of B. subtilis @10 g/l of water, applied at two intervals, effectively reduced the incidence of Phytophthora in coconut. The bacterial agent Pseudomonas fluoresecnes showed evident results against P. palmivora under in vitro and could aid in better disease management (Aruna and Motha, 2020). Thomas et al. (2011) identified 44 Bacillus species from the rhizospheric region and six Pseudomonas species from the rhizosphere that exhibited antagonistic activity against P. palmivora, making them potential bacterial BCAs. Similarily, the bacterial BCA, Paenibacillus polymyxa NMA1017 exhibited significant effectiveness in managing P. tropicalis causing black pod rot of cocoa, establishing it as potential BCA (Chávez-Ramírez et al., 2021; Wu et al., 2015) reported that compounds such as volatiles, siderophores produced by the bacteria, flagellin, and lipopeptides tend to engender induced systemic resistance against some fungal species.

Endophytes as potential BCAs

The endophytic bacteria obtained from the roots, stem, and leaves of the wild relative of black pepper Piper colubrinum was found effective and resistant against P. capsici. The growth was significant when the cuttings were bacterized (Irabor and Mmbaga, 2017; Kollakkodan et al., 2021) stated that endophytic bacteria, such as Bacillus species, were effective in controlling P. capsici and promoting bell pepper plant growth (Adama et al., 2020) stated that the cocoa tree naturally has endophytic bacteria, which can be used as potential antagonists against P. palmivora and P. megakarya. The bacterial endophytic isolates obtained from the healthy parts of the cocoa plant were screened for their antagonistic activity under in vitro conditions where P. aeruginosa and C. proteolyticum showed 100% inhibition against P. palmivora (Alsultan et al., 2019).
The antagonistic potential of bacterial endophytes against P. meadii was screened under in vitro conditions wherein six isolates were found virulent, among which EIL-2 showed maximum inhibition of 62.5% (Abraham et al., 2013). It was reported that the antagonism displayed against P. meadii may be used to control Phytophthora disease in vivo. The fungal endophytic Trichoderma strains were tested for their potential antagonism and efficacy where the strains of T. harzianum KUFA0436 and KUFA037 showed disease suppression by 43% and 48% (Sirikamonsathien et al., 2023). Dang et al. (2023) identified the endophytic isolates including Penicillium citrinium, Xylaria curta, and Clonostachys rosea to pose strong antagonistic activities against Phytophthora spp. which could serve as effective BCA against root rot disease in cinnamon.

Microbial consortia of potent BCAs

Despite the limited availability of BCAs, the fungal BCA such as Trichoderma species and the bacterial agents such as Bacillus species and Pseudomonas species have been proven effective in managing Phytophthora in spice and plantation crops by various researchers. The development of microbial consortia of T. harzianum, P. fluorescens, and B. megaterium reduced the severity of the disease along with the overall growth and development of palms (Naik et al., 2019).
In cardamom plants, the combined application of antagonistic organisms through rhizome and soil treatments reduced the capsule infection by 60% (Sivakumar et al., 2012). For managing foot rot of black pepper, combined applications of T. asperellum, P. fluorescens, and AMF are recommended when planting in the nursery and main field. The combination of BCAs has proven to be very effective against the growth and development of Phytophthora species because of the synergistic activities of the antagonists, which enhances their efficacy (Manasfi et al., 2018).

Integrated approaches

The combined applications of neem cake amended with Trichoderma 1 kg/vine showed increased microflora populations and reduced root infections. In nutmeg, the combination of treatments, such as a spray with 1% Bordeaux mixture and soil application with T. viride, showed progressive results in disease reduction (Sumbula and Mathew, 2015). The combined applications of potassium phosphonate with T. harzianum reduced foot rot incidence in black pepper. Since the actual disease of small cardamom solely depends on weather parameters, an IDM strategy involving plant sanitation, such as removal of diseased plant parts and shade regulation before the onset of monsoon, followed by chemical and biological methods such as the application of prophylactic fungicidal spray and soil application of Trichoderma species before the rainy season would be more helpful in managing this disease (Thomas and Suseela, 1995).
In cinnamon crops, the combination of cultural practices such as removal and destruction of the infected plant parts, shade lopping to ensure sunlight, availing proper drainage followed by chemical control measures viz., spraying of 1% Bordeaux mixture and soil drenching with copper oxychloride 0.25% reduced the incidence and spread of disease. In tree species, phytosanitary measures such as removing the infected and fallen nuts along with a prophylactic spray of 1% Bordeaux mixture help prevent the disease’s survival and spread (Anandaraj and Susheel Bhai, 2015). For managing black pod disease in cocoa, applying copper oxychloride followed by metalaxyl + mancozeb and suitable cultural practices showed good, reliable results in disease control (Peter and Chandramohan, 2014). Application of lime @ 200 kg/ha during pre-monsoon season followed by the application of 1% Bordeaux mixture as a foliar spray with suitable cultural practices such as removal of fallen nuts, ensuring proper drainage, and removal of excessive branches in the intercrops showed evident results in managing Phytophthora in areca nut fields (Balanagouda et al., 2021). The ultimate goal of IDM lies in achieving both efficient disease control and the mitigation of plant diseases, along with minimizing detrimental effects.

Conclusion and Future Prospects

Phytophthora infections pose an extreme threat to the sustainability and profitability of spices and plantation crop cultivation. Early detection of this dreadful pathogen using novel molecular methods offers an advantage in reducing inoculum and spread, resulting in lesser damage to spices and plantation crops. Adopting multi-pathed approaches in detection and management prove a holistic strategy in combating the devastating effects of Phytophthora pathogens in the fields of spice and plantation crops. This includes accurate diagnostics to avoid primary sources of infection, the use of disease-resistant planting materials, soil health and fertility improvement, the employment of novel biological agents, effective fungicides, and the utilization of pathbreaking new generation molecules against the Phytophthora species improving the production and protection of spices and plantation crops. Gaining a deeper understanding of the biology and pathogenicity mechanisms of Phytophthora species will ensure effective mitigation, reducing their impact on spices and plantation crops while enhancing their durability.
Furthermore, given that phytopathogens pose a threat globally, more attention is warranted as they are highly detrimental to spices and plantation crops worldwide. Identifying and addressing research gaps is essential. Prospects include timely pathogen detection using novel molecular tools, such as Pyrosequencing, for rapid and accurate quantification. Eco-friendly management strategies can contribute to reduced yield losses. Additionally, ensuring biocides is vital as alternatives to harmful fungicides and enhancing the future use of bio-capsules for low-volume applications and eco-friendly management. The advancement of nascent nanotechnological approaches holds promise for early detection diagnosis and management in their preliminary stages, ensuring crop safety and security. The widespread adoption of recent advancements in metabolomics, proteomics, and transcriptomics along with effective integrated disease management strategies holds high significance in saving the spice and plantation crops from the alarming danger of Phytophthora species worldwide.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

The authors thank Department of Plant Pathology, Agricultural College and Research Institute, Madurai and Department of Plant Protection, Horticultural College and Research Institute, Periyakulam, Tamil Nadu Agricultural University for the valuable support provided.

Correction

This article was corrected on April 18, 2025, for a typographical error in an author affiliation.

Fig. 1
Life cycle of Phytophthora species infecting spices and plantation crops. Phytophthora completes its life cycle viz. sexual and asexual phases. In case of asexual reproduction, the cycle begins through zoospore-favorable conditions ensure fast movement and successful infection-zoospores enter the encystment phase at low temperature-germination of encysted zoospore giving rise to infective hyphae-In sexual phase amphigynous type of reproduction takes place-giving rise to diploid oospores.
ppj-rw-07-2024-0108f1.jpg
Table 1
List of Phytophthora species and their host range and geographical distribution
Phytophthora sp. Host range Geographical distribution Reference
P. alni Alders Sweden, Latvia, Germany, Austria, Italy, Hungary, Europe Trzewik et al. (2021)
P. brassicae Brassicaceae Europe, North America Hermansen and Hoftun (2005)
P. cactorum Wide host range Cosmopolitan Hudler (2013)
P. capsici Wide host range Cosmopolitan Lamour et al. (2012)
P. cinnamomi Wide host range Southern Hemisphere Hardham and Blackman (2018)
P. citricola Wide host range Cosmopolitan Portz et al. (2011)
P. fragariae Strawberry Asia, Australia, New Zealand, Europe, North America Adams et al. (2020)
P. ilicis IIlex spp. Europe, North America Scanu et al. (2014)
P. infestans Solanaceous crops, Tomato, etc. Cosmopolitan McLeod et al. (2024)
P. lateralis Cuppreasceae family Cosmopolitan Sniezko et al. (2020)
P. litchi Litchi Asia, Europe Zhang et al. (2021)
P. meadii Wide host range Asia, Australia, Europe, Pacific Islands Dang et al. (2021)
P. megakarya Cocoa, Irvingia Africa, Asia Morales-Cruz et al. (2020)
P. melonis Cucurbitaceae and Anacardiaceae Asia Hashemi et al. (2020)
P. palmivora Wide host range Cosmopolitan Misman et al. (2022)
P. porri Allium spp.
Alnus spp.
USA, Japan, Netherlands, Europe Parthasarathy et al. (2016)
P. phaesoli Phaseolus spp. Africa, Asia, Europe, North and South America, Caribbean islands Santamaria et al. (2018)
P. quercina Quercus spp. Asia, Europe, and US Dorado et al. (2023)
P. ramorum Wide host range Europe, North America, USA Beltran et al. (2024)
P. sojae Fabaceae Australia, North America, South America, Asia, New Zealand Dorrance (2018)
P. syringae Wide host range Africa, Australia, Asia, North America, South America, Europe Harris and Xu (2003)
P. tropicalis Wide host range Pacific Islands, North America, Europe Chávez-Ramírez et al. (2021)
P. ulginosa Quercus spp. Europe Mora-Sala et al. (2019)
P. uniformis Alnus spp. France, Spain, Belgium, Slovenia, USA Redondo et al. (2017)
P. vignae Fabaceae and Rosaceae Asia, Australia Sun et al. (2021)
Table 2
Devastating impact of Phytophthora species and yield losses in key spice and plantation crops
Sl. no. Name of the spice/plantation crop Causal organism Disease name Symptomatology Yield loss (%) Reference
1 Black Pepper P. capsici Foot rot The disease initiates as dark, water-soaked lesions at the stem base leading to yellowing, wilting defoliation and dieback. In severe cases, the entire vine rots, collapses and dies. 25-30 Thomas and Naik (2017)
2 Cardamom P. meadii Capsule rot (Azhukal) The disease starts with discoloured, water-soaked lesions on capsules and leaves leading to rotting and shredding. Infected capsules turn brown emitting a foul smell and shed prematurely. In advanced stages, it spreads to panicles and tillers, causing complete plant decay and death. 30-40 Thomas et al. (2022)
3 Chilli P. capsici Phytophthora root rot Almost all stages of crop get affected viz., damping off, stem blight, fruit rot, leaf blight root rot eventually leading to complete death of the plant. 80-100 Shah et al. (2013)
4 Cinnamon P. cinnamomi Stripe canker Brown to black lesions which turn into vertically striped cankers on the bark region followed by gummy exudations, yellowing and wilting leading to dieback, rotting and death of the infected plant 10-40 Andrade-Hoyos et al. (2023)
5 Nutmeg P. meadii Fruit rot In the immature nuts the symptom appear as splitting and rotting of fruits which drop prematurely. In the mature nut it causes discolouration of the rind leading to rotting. As the infection advances the mace rots completely emitting a foul smell. 20-35 Sumbula and Matthew (2015)
6 Vanilla P. meadii Bean rot The infection starts from the bean tip and extends to the stalk, causing water-soaked, dark brown, and soft beans. In dry conditions, beans shrivel, while in moist conditions, they shed. Whitish pustules develop, leading to rotting, foul odour eventual bunch fall. 23-57 Jithya Dhanesh (2008)
7 Areca nut P. meadii/P. palmivora Fruit and bud rot Fruit rot disease manifests as water-soaked lesions on immature nuts later turning black soft and shrivelled, emitting a foul odour and fall off prematurely.
Similarly, the bud rot disease begins with yellowing and wilting of the central spindle leaf followed by rotting and foul odour. As the disease progress it leads to collapse of the crown and eventual death of the palm.
10-90 Balangouda et al. (2021)
8 Betel vine P. parasitiaca Foot and root rot Water-soaked lesions, rotted base, yellowing and wilting of vines as the infection advances it results in the death of vines. 30-100 Datta et al. (2011)
9 Cocoa P.palmivora/megakarya Black pod The fungus affects almost all stages leading to blackened, dried and mummified pods. The infected pods emit a fishy odour. 10-30 Merga (2022)
10 Oil palm P. palmivora Bud rot Chlorosis of the younger leaves followed by necrosis affecting the meristem, collapsing of spear leaf and complete death of the plant 27-90 Moreno-Chacón et al. (2013)
11 Coconut P. palmivora Bud rot Young palms are more susceptible, yellowing of leaves, rotting, withering, crown rots and turn slimy emitting a foul smell and the palm eventually dies. 7-21 Prathibha et al. (2023)
12 Rubber P. palmivora Abnormal leaf fall Dull grey to brown spots on leaves, fruits rot, Premature leaf shedding, rotting and foul odour. 38-56 Krishnan et al. (2019)
Table 3
Molecular tools used for detecting wide range of Phytophthora species in spices and plantation crops
Methodology Phytophthora species Primer Sequence (5′-3′) Reference
PCR P. capsici Pc1F GTATAGCAGAGGTTTAGTGAA Lan et al. (2013)
Pc1R ACTGAAGTTCTGCGTGCGTT
PCR P. megakarya Pmeg ITS_F/R TGCTCGAAAAGTAAAGCTTGC/AGGAAAAACGCCCAATAAGC Ali et al. (2016)
P. palmivora Ppal ITS_F/R AAAAGCGTGGCGTTGCT/AATCATACCACCACAGCTGAA
P.capsici/ P.citrophthora Pcap/cit ITS_F/R TCGAAAAGCGTGGTGTTG/GCCACAGCAGGAAAAGCATA
P.citrophthora Pcit ITS_F/R GGGTGTTGCTTGGCATTTT/CACAAAAACCGCAAGACACTT
Nested PCR P.nicotianae PNIC1 CAATAGTTGGGGGTCTTATT Grote et al. (2002)
PNIC2 GTATACCGAAGTACACATTAAG
P. capsici PC-1 GTCTTGTACCCTATCATGGCG Farhana et al. (2013)
PC-2 CGCCACAGCAGGAAAAGCATC
P. capsici Pc1F GTATAGCAGAGGTTTAGTGAA Lan et al. (2013)
Pc2R GACGTTTTAGTTAGAGCACTG
RT-PCR P. capsici Phyto_qPCR_F CTGAACAGGCGCTTATTGAATG Pandian et al. (2018)
Phyto_qPCR_R GAGATGCGCACCGAAGTGCA
RFLP P. meadii ITS1 and 4 TCCGTAGGTGAACCTGCGG CCTCCGCTTATTGATATGC and restriction enzymes such as Hinf I, Msp I, HaeIII, and RsaI were used. Chowdappa et al. (2003)
AFLP P. meadii Six AFLP Primers from A-F A (GACTGCGTACATGCAGGT), B (GACTGCGTACATGCAGGA), C (GACTGCGTACATGCAGGC), D (GACTGCGTACATGCAGAC), E (GACTGCGTACATGCAGAG), and F (GACTGCGTACATGCAGCG) Chowdappa et al. (2003)
AFLP P. capsici EcoRI, MseI GACTGCGTAC CAATTC
GATGAGTCCTGAGTAA
Bowers et al. (2007)
RPA P. capsici PC-YR-FP CAGATTGTAAGCAACCAAAGTTCAAGACGTTT Jeevalatha et al. (2021)
COM-YR-RP TACGAACCTATCGATCTCATGCAGCCACTG
P. tropicalis PT-YR-FP AAGCTCCAGATTGTAAG CACTTGTTA TCCATC Jeevalatha et al. (2021)
COM-YR-RP TACGAACCTATCGATCTCATGCAGCCACTG
LAMP P. capsici F3 GCTGCGGCGTTTAAAGGA Dong et al. (2015)
B3 AGTGCACACAAAGTTCCCAA
FIP ACCCACAGCAGGAAAAGCATT-GAGTGTTCGATTCGCGGTA
BIP GGCTTGGCTTTTGAATCGGCTT-TGGATCGACCCTCGACAG
LAMP P. palmivora AVM2-F3 CAGGGAACAGTTGTTTGGA Maizatul-Suriza et al. (2024)
AVM2-B3 CTGGCTTGGTCGAAGATG
AVM2-FIP CGCCGTCGTCAGCATCTTACGATG TCAATGTGGGTG
AVM2-BIP TCTCTGGAGTACGAGAGTGAC GTCGTCTTGCTCGAATGTG
AVM2-LF TGACTCCGATGGCAACTTC
AVM2-LB CATCGTCGCTTATCATCTCCT

PCR, polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction; RFLP, restriction fragment length polymorphism; AFLP, amplified fragment length polymorphism; RPA, recombinase polymerase amplification; LAMP, loop-mediated isothermal amplification.

References

Abad, Z. G., Burgess, T. I., Redford, A. J., Bienapfl, J. C., Srivastava, S., Mathew, R. and Jennings, K. 2023. IDphy: an international online resource for molecular and morphological identification of Phytophthora. Plant Dis. 107:987-998.
crossref pmid
Abraham, A., Philip, S., Kuruvilla Jacob, C. and Jayachandran, K. 2013. Novel bacterial endophytes from Hevea brasiliensis as biocontrol agent against Phytophthora leaf fall disease. BioControl 58:675-684.
crossref pdf
Adama, O., Klotioloma, C., Ibrahim, K., Ismaël, K. B., Maxwell, B. G. A., Sanogo, T. A. and Filali Maltof, A. 2020. Screening and selection in vitro and in vivo of cocoa tree (Theobroma cacao Linn) endophytic bacteria having antagonistic effects against Phytophthora spp. fungal agents responsible of black pod disease in Côte d’Ivoire. J. Appl. Environ. Microbiol. 8:25-31.
Adams, T. M., Armitage, A. D., Sobczyk, M. K., Bates, H. J., Tabima, J. F., Kronmiller, B. A., Tyler, B. M., Grünwald, N. J., Dunwell, J. M., Nellist, C. F. and Harrison, R. J. 2020. Genomic investigation of the strawberry pathogen Phytophthora fragariae indicates pathogenicity is associated with transcriptional variation in three key races. Front. Microbiol. 11:490.
crossref pmid pmc
Ali, S. S., Amoako-Attah, I., Bailey, R. A., Strem, M. D., Schmidt, M., Akrofi, A. Y., Surujdeo-Maharaj, S., Kolawole, O. O., Begoude, B. A. D., Ten Hoopen, G. M., Goss, E., Phillips-Mora, W., Meinhardt, L. W. and Bailey, B. A. 2016. PCR-based identification of cacao black pod causal agents and identification of biological factors possibly contributing to Phytophthora megakarya’s field dominance in West Africa. Plant Pathol. 65:1095-1108.
Alsultan, W., Vadamalai, G., Khairulmazmi, A., Saud, H. M., Al-Sadi, A. M., Rashed, O., Jaaffar, A. K. M. and Nasehi, A. 2019. Isolation, identification and characterization of endophytic bacteria antagonistic to Phytophthora palmivora causing black pod of cocoa in Malaysia. Eur. J. Plant Pathol. 155:1077-1091.
crossref pdf
Ambikapathy, J., Marshall, J. S., Hocart, C. H. and Hardham, A. R. 2002. The role of proline in osmoregulation in Phytophthora nicotianae. Fungal Genet. Biol. 35:287-299.
crossref pmid
Anandaraj, M. and Suseela Bhai, R. 2015. Integrated management of Phytophthora diseases in spices. Indian Hortic. 60:58-64.
Andrade-Hoyos, P., Romero-Arenas, O., Silva-Rojas, H. V., Luna-Cruz, A., Espinoza-Pérez, J., Mendieta-Moctezuma, A. and Urrieta-Velázquez, J. A. 2023. Cinnamom verum plantations in the lowland tropical forest of Mexico are affected by Phytophthora cinnamomi, phylogenetically classified into Phytophthora subclade 7c. Horticulturae 9:187.
crossref
Aruna, K. and Motha, K. 2020. Studies on in vitro antagonism of native biocontrol agents on coconut stem bleeding and bud rot disease pathogens. Int. J. Curr. Microbiol. Appl. Sci. 9:2192-2202.
crossref
Avila-Quezada, G. D. and Rai, M. 2023. Novel nanotechnological approaches for managing Phytophthora diseases of plants. Trends Plant Sci. 28:1070-1080.
crossref pmid
Babadoost, M. 2016. Oomycete diseases of cucurbits: history, significance, and management. Hortic. Rev. 44:279-314.
crossref pdf
Balanagouda, P., Vinayaka, H., Maheswarappa, H. P. and Narayanaswamy, H. 2021. Phytophthora diseases of arecanut in India: prior findings, present status and future prospects. Indian Phytopathol. 74:561-572.
crossref pdf
Barreto, M. A., Santos, J. C. S., Corrêa, R. X., Luz, E. D. M. N.n, Marelli, J. and Souza, A. P. 2015. Detection of genetic resistance to cocoa black pod disease caused by three Phytophthora species. Euphytica 206:677-687.
crossref pdf
Bartnicki-Garcia, S. and Wang, M. C. 1983. Biochemical aspects of morphogenesis in Phytophthora. In: Phytophthora: its biology, taxonomy, ecology and pathology, eds. by D. C. Erwin, S. Bartnicki-Garcia and P. H. Tsao, pp. 121-137. American Phytopathological Society, St. Paul, MN, USA.
Baruah, I. K., Shao, J., Ali, S. S., Schmidt, M. E., Meinhardt, L. W., Bailey, B. A. and Cohen, S. P. 2024. Cacao pod transcriptome profiling of seven genotypes identifies features associated with post-penetration resistance to Phytophthora palmivora. Sci. Rep. 14:4175.
crossref pmid pmc pdf
Beakes, G. W. and Sekimoto, S. 2009. The evolutionary phylogeny of oomycetes: insights gained from studies of holocarpic parasites of algae and invertebrates. In: Oomycete genetics and genomics: diversity, interactions, and research tools, eds. by K. Lamour and S. Kamoun, pp. 1-24. John Wiley and Sons, Inc., Hoboken, NJ, USA.
crossref
Beltran, A., Laubray, S., Ioos, R., Husson, C. and Marçais, B. 2024. Low persistence of Phytophthora ramorum (Werres, De Cock, and Man in ‘t Veld) in western France after implementation of eradication measures. Ann. For. Sci. 81:7.
crossref pdf
Blair, J. E., Coffey, M. D., Park, S.-Y., Geiser, D. M. and Kang, S. 2008. A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet. Biol. 45:266-277.
crossref pmid
Bourret, T. B., Choudhury, R. A., Mehl, H. K., Blomquist, C. L., McRoberts, N. and Rizzo, D. M. 2018. Multiple origins of downy mildews and mito-nuclear discordance within the paraphyletic genus Phytophthora. PLoS ONE 13:e0192502.
crossref pmid pmc
Bowers, J. H., Martin, F. N., Tooley, P. W. and Luz, E. D. M. N.n 2007. Genetic and morphological diversity of temperate and tropical isolates of Phytophthora capsici. Phytopathology 97:492-503.
crossref pmid
Brasier, C. M. 1983. Problems and prospects in Phytophthora research. In: Phytophthora: its biology, taxonomy, ecology, and pathology, eds. by D. C. Erwin, S. Bartnicki-Garcia and S. Tsao, pp. 351-364. American Phytopathological Society Press, St. Paul, MN, USA.
Brasier, C., Scanu, B., Cooke, D. and Jung, T. 2022. Phytophthora: an ancient, historic, biologically and structurally cohesive and evolutionarily successful generic concept in need of preservation. IMA Fungus 13:12.
crossref pmid pmc pdf
Chávez-Ramírez, B., Rodríguez-Velázquez, N. D., Mondragón-Talonia, C. M., Avendaño-Arrazate, C. H., Martínez-Bolaños, M., Vásquez-Murrieta, M. S. and Estrada de los Santos, P. 2021. Paenibacillus polymyxa NMA1017 as a potential biocontrol agent of Phytophthora tropicalis, causal agent of cacao black pod rot in Chiapas, Mexico. Antonie Van Leeuwenhoek 114:55-68.
crossref pmid pdf
Chowdappa, P., Brayford, D., Smith, J. and Flood, J. 2003. Identity of Phytophthora associated with arecanut and its relationship with rubber and cardamom isolates based on RFLP of PCR-amplified ITS regions of rDNA and AFLP fingerprints. Cuur. Sci. 85:585-587.
Chowdappa, P., Saraswathy, N., Vinayagopal, K. and Somala, M. 2000. Control of fruit rot of arecanut through polythene covering. Indian Phytopathol. 53:321.
Chowdappa, P., Sharma, P., Anandaraj, M. and Khetarpal, R. K. 2014. Diseases of plantation crops. Today And Tomorrows Printers and Publisher, New Delhi, India. pp. 274.
Cissin, J., Bhai, R. S., Vinitha, K. B., Babu, K. N. and Anandaraj, M. 2016. Cross species amplification of microsatellite loci from Phytophthora spp to assess genetic diversity among the Phytophthora isolates from black pepper. J. Spices Aromat. Crops 25:104-112.
Cooke, D. E. L., Drenth, A., Duncan, J. M., Wagels, G. and Brasier, C. M. 2000. A molecular phylogeny of Phytophthora and related oomycetes. Fungal Genet. Biol. 30:17-32.
crossref pmid
Cooley, M. B., Pathirana, S., Wu, H. J., Kachroo, P. and Klessig, D. F. 2000. Members of the Arabidopsis HRT/RPP8 family of resistance genes confer resistance to both viral and oomycete pathogens. Plant Cell 12:663-676.
crossref pmid pmc
Dang, Q. N., Burgess, T. I., McComb, J., Pham, T. Q., Le, B. V., Tran, T. V., Nguyen, L. T. and Hardy, G. E. S. J.n 2023. Fungal and bacterial endophytes antagonistic to Phytophthora species causing root rot in Cinnamomum cassia. Mycol. Prog. 22:28.
crossref pdf
Dang, Q. N., Pham, T. Q., Arentz, F., Hardy, G. E. S. and Burgess, T. I. 2021. New Phytophthora species in clade 2a from the Asia-Pacific region including a re-examination of P. colocasiae and P. meadii. Mycol. Prog. 20:111-129.
crossref pdf
Dasgupta, B., Dutta, P. and Das, S. 2011. Biological control of foot rot of betelvine (Piper betel L.) caused by Phytophthora parasitica Dastur. J. Plant Prot. Sci. 3:15-19.
Datta, P., Dasgupta, B. and Sengupta, D. K. 2011. Efficacy of Trichoderma spp. against Phytophthora parasitica and Pythium spp. causing foot rot and leaf rot of betelvine (Piper betle L.). J. Crop Weed 7:202-209.
de Ita, MÁV, Fátima, J. H., Lezama, C. P., Simón, A. B., Cortés, G. L. and Romero-Arenas, O. 2021. Bio-controller effect of four native strains of Trichoderma species, on Phytophthora capsici in Manzano chili (Capsicum pubescens) in Puebla-Mexico. J. Pure Appl. Microbiol. 15:998-1005.
crossref
De Vrieze, M., Pandey, P., Bucheli, T. D., Varadarajan, A. R., Ahrens, C. H., Weisskopf, L. and Bailly, A. 2015. Volatile organic compounds from native potato-associated Pseudomonas as potential anti-oomycete agents. Front. Microbiol. 6:1295.
pmid pmc
Dong, Z., Liu, P., Li, B., Chen, G., Weng, Q. and Chen, Q. 2015. Loop-mediated isothermal amplification assay for sensitive and rapid detection of Phytophthora capsici. Can. J. Plant Pathol. 37:485-494.
crossref
Dorado, F. J., Corcobado, T., Brandano, A., Abbas, Y., Alcaide, F., Janoušek, J., Jung, T., Scanu, B. and Solla, A. 2023. First report of dieback of Quercus suber trees associated with Phytophthora quercina in Morocco. Plant Dis. 107:1246.
crossref pmid
Dorrance, A. E. 2018. Management of Phytophthora sojae of soybean: a review and future perspectives. Can. J. Plant Pathol. 40:210-219.
crossref
Drake, K. E., Moore, J. M., Bertrand, P., Fortnum, B., Peterson, P. and Lewis, R. S. 2015. Black shank resistance and agronomic performance of flue-cured tobacco lines and hybrids carrying the introgressed Nicotiana rustica region. Wz. Crop Sci. 55:79-86.
Drenth, A. and Guest, D. I. 2004. 7.1 Principles of Phytophthora disease management. In: ACIAR Monograph 114, Diversity and Management of Phytophthora in Southest Asia, eds. by A. Drenth and D. I. Guest, pp. 154-160. Australian Centre for International Agricultural Research, Canberra, Austrailia.
Drenth, A. and Sendall, B. 2001. Practical guide to detection and identification of Phytophthora, version 1.0. Tropical Plant Protection, Brisbane, Austrailia. pp. 41.
El-Sayed, A. S. A. and Ali, G. S. 2020. Aspergillus flavipes is a novel efficient biocontrol agent of Phytophthora parasitica. Biol. Control 140:104072.
crossref
Erwin, D. C. and Ribeiro, O. K. 1996. Phytophthora diseases worldwide. Plant Pathol. 47:224-226.
crossref pdf
Fabritius, A.-L., Cvitanich, C. and Judelson, H. S. 2002. Stage-specific gene expression during sexual development in Phytophthora infestans. Mol. Microbiol. 45:1057-1066.
crossref pmid
Farhana, M. D. S. N.n, Rahamah Bivi, M., Khairulmazmi, A., Wong, S. K. and Sariah, M. 2013. Morphological and molecular characterization of Phytophthora capsici, the causal agent of foot rot disease of black pepper in Sarawak, Malaysia. Int. J. Agric. Biol. 15:1083-1090.
Ghislain, M., Byarugaba, A. A., Magembe, E., Njoroge, A., Rivera, C., Román, M. L., Tovar, J. C., Gamboa, S., Forbes, G. A., Kreuze, J. F., Barekye, A. and Kiggundu, A. 2019. Stacking three late blight resistance genes from wild species directly into African highland potato varieties confers complete field resistance to local blight races. Plant Biotechnol. J. 17:1119-1129.
crossref pmid pmc pdf
Gisbert, C., Sánchez-Torres, P., Raigón, M. D. and Nuez, F. 2010. Phytophthora capsici resistance evaluation in pepper hybrids: agronomic performance and fruit quality of pepper grafted plants. J. Food Agric. Environ. 8:116-121.
Granke, L. L., Quesada-Ocampo, L., Lamour, K. and Hausbeck, M. K. 2012. Advances in research on Phytophthora capsici on vegetable crops in the United States. Plant Dis. 96:1588-1600.
crossref pmid
Grote, D., Olmos, A., Kofoet, A., Tuset, J. J., Bertolini, E. and Cambra, M. 2002. Specific and sensitive detection of Phytophthora nicotianae by simple and nested-PCR. Eur. J. Plant Pathol. 108:197-207.
crossref pdf
Guha Roy, S. 2015. Phytophthora: a member of the sixth kingdom revisited as a threat to food security in the twenty-first century. In: Value addition of horticultural crops: recent trends and future directions, eds. by A. Sharangi and S. Datta, pp. 325-337. Springer, New Delhi, India.
Haidar, R., Fermaud, M., Calvo-Garrido, C., Roudet, J. and Deschamps, A. 2016. Modes of action for biological control of Botrytis cinerea by antagonistic bacteria. Phytopathol. Mediterr. 55:301-322.
Hansen, E. M., Reeser, P. W. and Sutton, W. 2012. Phytophthora beyond agriculture. Annu. Rev. Phytopathol. 50:359-378.
crossref pmid
Hardham, A. R. 2001. The cell biology behind Phytophthora pathogenicity. Australas. Plant Pathol. 30:91-98.
Hardham, A. R. and Blackman, L. M. 2018. Phytophthora cinnamomi. Mol. Plant Pathol. 19:260-285.
crossref pmid pmc pdf
Harris, D. C. and Xu, X.-M. 2003. Conditions for infection of apple by Phytophthora syringae. J. Phytopathol. 151:190-194.
crossref
Hashemi, L., Golparvar, A. R., Nasr-Esfahani, M. and Golabadi, M. 2020. Expression analysis of defense-related genes in cucumber (Cucumis sativus L.) against Phytophthora melonis. Mol. Biol. Rep. 47:4933-4944.
crossref pmid pdf
Herath, A. 2002. Spice sector of Sri Lanka: issues challenges and opportunities for next decade. Econ. Rev. 2002:12-21.
Hermansen, A. and Hoftun, H. 2005. Effect of storage in controlled atmosphere on post-harvest infections of Phytophthora brassicae and chilling injury in Chinese cabbage (Brassica rapa L pekinensis (Lour) Hanelt). J. Sci. Food Agric. 85:1365-1370.
crossref
Ho, H. H. 2018. The taxonomy and biology of Phytophthora and Pythium. J. Bacteriol. Mycol. Open Access 6:40-45.
Huang, J., Wu, J., Li, C., Xiao, C. and Wang, G. 2010. Detection of Phytophthora nicotianae in soil with real-time quantitative PCR. J. Phytopathol. 158:15-21.
crossref
Hudler, G. W. 2013. Phytophthora cactorum. For. Phytophthoras 3:1.
Hyder, S., Gondal, A. S., Rizvi, Z. F., Ahmad, R., Alam, M. M., Hannan, A., Ahmed, W., Fatima, N. and Inam-ul-Haq, M. 2020. Characterization of native plant growth promoting rhizobacteria and their anti-oomycete potential against Phytophthora capsici affecting chilli pepper (Capsicum annum L.). Sci. Rep. 10:13859.
crossref pmid pmc pdf
Irabor, A. and Mmbaga, M. T. 2017. Evaluation of selected bacterial endophytes for biocontrol potential against Phytophthora blight of bell pepper (Capsicum annuum L.). J. Plant Pathol. Microbiol. 8:424.
Jang, Y., Yang, E., Cho, M., Um, Y., Ko, K. and Chun, C. 2012. Effect of grafting on growth and incidence of Phytophthora blight and bacterial wilt of pepper (Capsicum annuum L.). Hortic. Environ. Biotechnol. 53:9-19.
crossref pdf
Jeevalatha, A., Biju, C. N. and Bhai, R. S. 2021. Ypt1 gene-based recombinase polymerase amplification assay for Phytophthora capsici and P. tropicalis detection in black pepper. Eur. J. Plant Pathol. 159:863-875.
crossref pdf
Jiang, R., Li, J., Tian, Z., Du, J., Armstrong, M., Baker, K., Lim, J. T.-Y., Vossen, J. H., He, H., Portal, L., Zhou, J., Bonierbale, M., Hein, I., Lindqvist-Kreuze, H. and Xie, C. 2018. Potato late blight field resistance from QTL dPI09c is conferred by the NB-LRR gene R8. J. Exp. Bot. 69:1545-1555.
crossref pmid pmc
Jin, J., McCorkle, K. L., Cornish, V., Carbone, I., Lewis, R. S. and Shew, H. D. 2022. Adaptation of Phytophthora nicotianae to multiple sources of partial resistance in tobacco. Plant Dis. 106:906-917.
crossref pmid
Jithya Dhanesh, R. S. B. 2008. Occurrence of fungal diseases in vanilla (Vanilla planifolia Andrews) in Kerala. J. Spices Aromat. Crops 17:140-148.
Judelson, H. S. 2009. Sexual reproduction in oomycetes: biology, diversity and contributions to fitness. In: Oomycete genetics and genomics: diversity, interactions and research tools, eds. by K. Lamour and S. Kamoun, pp. 121-138. John Wiley & Sons Inc, Hoboken, NJ, USA.
crossref
Judelson, H. S. and Blanco, F. A. 2005. The spores of Phytophthora: weapons of the plant destroyer. Nat. Rev. Microbiol. 3:47-58.
crossref pmid pdf
Jung, T., Jung, M. H., Cacciola, S. O., Cech, T., Bakonyi, J., Seress, D., Mosca, S., Schena, L., Seddaiu, S., Pane, A., di San Lio, G. M., Maia, C., Cravador, A., Franceschini, A. and Scanu, B. 2017. Multiple new cryptic pathogenic Phytophthora species from Fagaceae forests in Austria, Italy and Portugal. IMA Fungus 8:219-244.
crossref pmid pmc pdf
Khan, A. U., Khan, A. U., Khanal, S. and Gyawali, S. 2020. Insect pests and diseases of cinnamon (Cinnamomum verum Presi.) and their management in agroforestry system: a review. Acta Entomol. Zool. 1:51-59.
crossref
Khoury, W. E. and Makkouk, K. 2010. Integrated plant disease management in developing countries. J. Plant Pathol. 92(4 Suppl):S35-S42.
Kim, H.-J., Lee, H.-R., Jo, K.-R., Mortazavian, S. M. M., Huigen, D. J., Evenhuis, B., Kessel, G., Visser, R. G. F., Jacobsen, E. and Vossen, J. H. 2012. Broad spectrum late blight resistance in potato differential set plants MaR8 and MaR9 is conferred by multiple stacked R genes. Theor. Appl. Genet. 124:923-935.
crossref pmid pmc
Kollakkodan, N., Anith, K. N. and Nysanth, N. S. 2021. Endophytic bacteria from Piper colubrinum suppress Phytophthora capsici infection in black pepper (Piper nigrum L.) and improve plant growth in the nursery. Arch. Phytopathol. Plant Prot. 54:86-108.
crossref
Krishnan, A., Joseph, L. and Roy, C. B. 2019. An insight into Hevea-Phytophthora interaction: the story of Hevea defense and Phytophthora counter defense mediated through molecular signalling. Curr. Plant Biol. 17:33-41.
crossref
Kroon, L. P. N. M.n, Bakker, F. T., Van Den Bosch, G. B. M., Bonants, P. J. M. and Flier, W. G. 2004. Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genet. Biol. 41:766-782.
crossref pmid
Kroon, L. P. N. M.n, Brouwer, H., de Cock, A. W. A. M.n and Govers, F. 2012. The genus Phytophthora anno 2012. Phytopathology 102:348-364.
crossref pmid
Kumar, K. K., Sridhar, J., Murali-Baskaran, R. K., Senthil-Nathan, S., Kaushal, P., Dara, S. K. and Arthurs, S. 2019. Microbial biopesticides for insect pest management in India: current status and future prospects. J. Invertebr. Pathol. 165:74-81.
crossref pmid
Kumar, M., Reddy, K. M., Sriram, S. and Yadav, R. K. 2021. Inheritance of resistance in chilli against root and collar rot caused by Phytophthora capsici. J. Plant Pathol. 103:769-775.
crossref pdf
Kumar, N. R., Kumar, K. R. and Seshakiran, K. 2012. Management of Phytophthora foot rot disease in black pepper. Green Farming Int. J. Appl. Hortic. Sci. 3:583-585.
Lamour, K. H., Stam, R., Jupe, J. and Huitema, E. 2012. The oomycete broad-host-range pathogen Phytophthora capsici. Mol. Plant Pathol. 13:329-337.
crossref pmid pmc
Lan, C. Z., Liu, P. Q., Li, B. J., Chen, Q. H. and Weng, Q. Y. 2013. Development of a specific PCR assay for the rapid and sensitive detection of Phytophthora capsici. Australas. Plant Pathol. 42:379-384.
crossref pdf
Latha, P., Rajeswri, E., Sudhalakshmi, C., Suresh, J., Karthikeyan, M., Sumitha, S. and Bosco, A. J. 2023. Biocontrol agents for sustainable management of bud rot disease in coconut nursery. J. Plant. Crops 51:133-141.
crossref pdf
Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25:402-408.
crossref pmid
Lucas, G. B. 1975. Diseases of tobacco: biological consulting associates. Raleigh, NC, USA. pp. 621.
Lucas, P. 2006. Diseases caused by soil-borne pathogens. In: The epidemiology of plant diseases, eds. by B. Cooke, D. Jones and B. Kaye, pp. 373-386. Springer, Dordrecht, The Netherlands.
crossref
Lucas, P. and Sarniguet, A. 1998. Biological control of soil-borne pathogens with resident versus introduced antagonists: should diverging approaches become strategic convergence? In: Conservation biological control, eds. by P. Barbosa, pp. 351-370. Academic Press, San Diego, CA, USA.
Maizatul-Suriza, M., Dickinson, M., Al-Jaf, B. and Madihah, A. Z. 2024. Cross-pathogenicity of Phytophthora palmivora associated with bud rot disease of oil palm and development of biomarkers for detection. World J. Microbiol. Biotechnol. 40:55.
crossref pmid pdf
Manasfi, Y., Cannesan, M.-A., Riah, W., Bressan, M., Laval, K., Driouich, A., Vicré, M. and Trinsoutrot-Gattin, I. 2018. Potential of combined biological control agents to cope with Phytophthora parasitica, a major pathogen of Choisya ternata. Eur. J. Plant Pathol. 152:1011-1025.
crossref pdf
Martínez, L. G. 2009. Early identification and integrated management of the bud rot disease. Palmas 30:63-77.
McCoy, A. G., Noel, Z. A., Jacobs, J. L., Clouse, K. M. and Chilvers, M. I. 2022. Phytophthora sojae pathotype distribution and fungicide sensitivity in Michigan. Plant Dis. 106:425-431.
crossref pmid
McGregor, C., Waters, V., Nambeesan, S., MacLean, D., Candole, B. L. and Conner, P. 2011. Genotypic and phenotypic variation among pepper accessions resistant to Phytophthora capsici. HortScience 46:1235-1240.
crossref
McLeod, A., De Villiers, D., Sullivan, L., Coertze, S. and Cooke, D. E. L. 2024. First report of Phytophthora infestans lineage EU23 causing potato and tomato late blight in South Africa. Plant Dis. 108:231.
crossref pmid
Merga, J. 2022. Epidemiology and management strategies of cocoa black pod (Phytophthora spp.). Plant Pathol. Quar 12:34-39.
crossref
Miles, T. D., Martin, F. N. and Coffey, M. D. 2015. Development of rapid isothermal amplification assays for detection of Phytophthora spp. in plant tissue. Phytopathology 105:265-278.
crossref pmid
Ministry of Agriculture and Farmers Welfare 2022-2023. Second advance estimate for the year 2022-23 released for area and production of horticultural crops. Ministry of Agriculture and Farmers Welfare, New Delhi, India.
Misman, N., Samsulrizal, N. H., Noh, A. L., Wahab, M. A., Ahmad, K. and Azmi, N. S. A. 2022. Host range and control strategies of Phytophthora palmivora in Southeast Asia perennial crops. Pertanika J. Trop. Agric. Sci. 45:991-1019.
crossref
Mohammadbagheri, L., Nasr-Esfahani, M., Al-Sadi, A. M., Khankahdani, H. H. and Ghadirzadeh, E. 2022. Screening for resistance and genetic population structure associated with Phytophthora capsici-pepper root and crown rot. Physiol. Mol. Plant Pathol. 122:101924.
crossref
Morales-Cruz, A., Ali, S. S., Minio, A., Figueroa-Balderas, R., García, J. F., Kasuga, T., Puig, A. S., Marelli, J.-P., Bailey, B. A. and Cantu, D. 2020. Independent whole-genome duplications define the architecture of the genomes of the devastating West African cacao black pod pathogen Phytophthora megakarya and its close relative Phytophthora palmivora. G3 (Bethesda) 10:2241-2255.
crossref pmid pmc pdf
Mora-Sala, B., Gramaje, D., Abad-Campos, P. and Berbegal, M. 2019. Diversity of Phytophthora species associated with Quercus ilex L. in three Spanish regions evaluated by NGS. Forests 10:979.
crossref
Moreno-Chacón, A. L., Camperos-Reyes, J. E., Diazgranados, RAÁ and Romero, H. M. 2013. Biochemical and physiological responses of oil palm to bud rot caused by Phytophthora palmivora. Plant Physiol. Biochem. 70:246-251.
crossref pmid
Mucherino Muñoz, J. J., de Melo, C. A. F., Santana Silva, R. J., Luz, E. D. M. N.n and Corrêa, R. X. 2021. Structural and functional genomics of the resistance of cacao to Phytophthora palmivora. Pathogens 10:961.
crossref pmid pmc
Mukhopadhyay, R. and Kumar, D. 2020. Trichoderma: a beneficial antifungal agent and insights into its mechanism of biocontrol potential. Egypt. J. Biol. Pest Control 30:133.
crossref pdf
Naik, B. G., Maheshwarappa, H. P., Nagamma, G. and Latha, S. 2019. Management of fruit rot disease of arecanut (Areca catechu L.) caused by (Phytophthora meadii Mc Rae.). Int. J. Curr. Microbiol. Appl. Sci. 8:837-847.
crossref
Nguyen, Q. N., Linh, M. X., Nguyen, T. L. P., Nguyen, M. T. and Pham, T. 2022. Isolation of antagonistic rhizosphere bacteria toward Phytophthora capsici induce Phytophthora blight in pepper (Piper nigrum). Chem. Eng. Trans. 97:265-270.
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and Hase, T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63.
crossref pmid pmc
O’Brien, P. A., Williams, N. and Hardy, G. E. S. 2009. Detecting Phytophthora. . Crit. Rev. Microbiol. 35:169-181.
crossref pmid
O’Neill, N. R., van Berkum, P., Lin, J. J., Kuo, J., Ude, G. N., Kenworthy, W. and Saunders, J. A. 1997. Application of amplified restriction fragment length polymorphism for genetic characterization of Colletotrichum pathogens of alfalfa. Phytopathology 87:745-750.
crossref pmid
Pandian, R. T. P., Bhat, A. I., Biju, C. N. and Sasi, S. 2018. Development of diagnostic assays for rapid and sensitive detection of Phytophthora infecting major spices and plantation crops. J. Spices Aromat. Crops 27:119-130.
crossref pdf
Parthasarathy, S., Rajamanickam, S. and Muthamilan, M. 2016. Allium diseases: a global perspective. Innov. Farming 1:171-178.
Patil, B., Sridhara, S., Pruthviraj Narayanaswamy, H., Hegde, V. and Mishra, A. K. 2023. Efficacy of new generation oomycete-specific fungicides on life stages of Phytophthora meadii and field evaluation through bunch spraying system. Crop Prot. 168:106232.
crossref
Peter, P. K. and Chandramohan, R. 2014. Integrated management of black pod disease of cocoa caused by Phytophthora palmivora. Int. J. Plant Prot. 7:107-110.
Ping, J., Fitzgerald, J. C., Zhang, C., Lin, F., Bai, Y., Wang, D., Aggarwal, R., Rehman, M., Crasta, O. and Ma, J. 2016. Identification and molecular mapping of Rps11, a novel gene conferring resistance to Phytophthora sojae in soybean. Theor. Appl. Genet. 129:445-451.
crossref pmid pdf
Portz, R. L., Fleischmann, F., Koehl, J., Fromm, J., Ernst, D., Pascholati, S. F. and Osswald, W. F. 2011. Histological, physiological and molecular investigations of Fagus sylvatica seedlings infected with Phytophthora citricola. For. Pathol. 41:202-211.
crossref
Prathibha, V. H., Daliyamol Rajkumar Hegde, V. and Chandran, K. P. 2023. Sustainable management of bud rot disease of coconut. Bangladesh J. Bot. 52:749-753.
crossref pdf
Rachana, K. E., Gangaraj, K. P., Muralikrishna, K. S., Antony, G., Prathibha, V. H. and Rajesh, M. K. 2024. Resistance gene analogs (RGAs) of coconut respond differentially to Phytophthora palmivora and exogenous salicylic acid and methyl jasmonate. Plant Physiol. Rep. 29:421-437.
crossref pdf
Rahman, M. Z., Uematsu, S., Kimishima, E., Kanto, T., Kusunoki, M., Motohashi, K., Ishiguro, Y., Suga, H. and Kageyama, K. 2015. Two plant pathogenic species of Phytophthora associated with stem blight of Easter lily and crown rot of lettuce in Japan. Mycoscience 56:419-433.
crossref
Raymaekers, K., Ponet, L., Holtappels, D., Berckmans, B. and Cammue, B. P. A. 2020. Screening for novel biocontrol agents applicable in plant disease management: a review. Biol. Control 144:104240.
crossref
Redondo, MÁ, Thomsen, I. M. and Oliva, J. 2017. First report of Phytophthora uniformis and P. plurivora causing stem cankers on Alnus glutinosa in Denmark. Plant Dis. 101:512.
crossref
Reeves, G., Monroy-Barbosa, A. and Bosland, P. W. 2013. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici. Phytopathology 103:472-478.
crossref pmid
Rini, C. R. and Remya, J. 2020. Management of Phytophthora capsici infection in black pepper (Piper nigrum L.) using new generation fungicides and biopesticide. Int. J. Agric. Environ. Biotechnol. 13:71-74.
Sagaff, S. A. S., Ali, N. S., Mahyudin, M. M., Wong, M. Y. and Yusop, M. R. 2022. Emerging and existing major leaf diseases of Hevea brasiliensis in Malaysia. J. Curr. Opin. Crop Sci. 3:34-47.
crossref pdf
Saltos, L. A., Monteros-Altamirano, Á, Reis, A. and Garcés-Fiallos, F. R. 2022. Phytophthora capsici: the diseases it causes and management strategies to produce healthier vegetable crops. Hortic. Bras. 40:5-17.
crossref
Sanogo, S. and Ji, P. 2013. Water management in relation to control of Phytophthora capsici in vegetable crops. Agric. Water Manag. 129:113-119.
crossref
Santamaria, L., Ernest, E. G., Gregory, N. F. and Evans, T. A. 2018. Inheritance of resistance in lima bean to Phytophthora phaseoli, the causal agent of downy mildew of lima bean. HortScience 53:777-781.
crossref
Scanu, B., Linaldeddu, B., Pérez-Sierra, A., Deidda, A. and Franceschini, A. 2014. Phytophthora ilicis as a leaf and stem pathogen of Ilex aquifolium in Mediterranean islands. Phytopathol. Mediterr. 53:480-490.
Scortichini, M. 2022. Sustainable management of diseases in horticulture: conventional and new options. Horticulturae 8:517.
crossref
Scott, P., Bader, MK-F, Burgess, T., Hardy, G. and Williams, N. 2019. Global biogeography and invasion risk of the plant pathogen genus Phytophthora. Environ. Sci. Policy 101:175-182.
Shah, S. F. A., Hussain, S., Shahid, M., Farooq Rauf, M. A. and Rahman, J. 2013. Molecular detection of Phytophthora capsici from chilli (Capsicum annum L.) and its response to selected growth media and vegetable extracts. Int. J. Dev. Sustain. 2:1312-1323.
Shalini, S. and Rajashekhar, M. 2006. Isolation, identification and screening of potential antagonistic microorganism for the biocontrol of Phytophthora meadii McRae causing fruit rot of arecanut (Areca catechu L.). J. Biol. Control 20:241-246.
Shin, J., Kim, J., Kim, H., Kang, B., Kim, K., Lee, J. and Kim, H. T. 2010. Efficacy of fluopicolide against Phytophthora capsici causing pepper Phytophthora blight. Plant Pathol. J. 26:367-371.
crossref
Sirikamonsathien, T., Kenji, M. and Dethoup, T. 2023. Potential of endophytic Trichoderma in controlling Phytophthora leaf fall disease in rubber (Hevea brasiliensis). Biol. Control 179:105175.
crossref
Situ, J., Xi, P., Lin, L., Huang, W., Song, Y., Jiang, Z. and Kong, G. 2022. Signal and regulatory mechanisms involved in spore development of Phytophthora and Peronophythora. Front. Microbiol. 13:984672.
crossref pmid pmc
Sivakumar, G., Dhanya, M. K. and Murugan, M. 2015. Induced defense response in small cardamom plants by Bacillus subtilis strain Bs against capsule rot pathogen, Phytophthora meadii. J. Spices Aromat. Crops 24:12-17.
Sivakumar, G., Rajkumar, A. J. and Rangeshwaran, R. 2012. Bioefficacy of peat formulation of bacterial antagonists on growth promotion and disease suppression in cardamom (Elettaria cardamomum Maton). J. Biol. Control 26:255-259.
Sniezko, R. A., Johnson, J. S., Reeser, P., Kegley, A., Hansen, E. M., Sutton, W. and Savin, D. P. 2020. Genetic resistance to Phytophthora lateralis in Port-Orford-cedar (Chamaecyparis lawsoniana): basic building blocks for a resistance program. Plants People Planet 2:69-83.
crossref pdf
Sriwati, R., Chamzhurni, T., Alfizar Soekarno, B. P. W., Maulidia, V. and Sahputra, I. 2019. Pellet formulation of Trichoderma isolated from Aceh with potential for biocontrol of Phytophthora sp. on cacao sedlings. J. Appl. Sci. Technol. 3:202-212.
crossref pdf
Sumbula, V. and Mathew, S. K. 2015. Management of Phytophthora leaf fall disease of nutmeg (Myristica fragrans Houtt.). J. Trop. Agric. 53:180-186.
Sun, F., Sun, S., Ye, W., Duan, C., Li, B., Shan, W. and Zhu, Z. 2021. Genome sequence data of three formae speciales of Phytophthora vignae causing Phytophthora stem rot on different Vigna species. Plant Dis. 105:3732-3735.
crossref pmid
Suraby, E. J., Prasath, D., Babu, K. N. and Anandaraj, M. 2020. Identification of resistance gene analogs involved in Phytophthora capsici recognition in black pepper (Piper nigrum L.). J. Plant Pathol. 102:1121-1131.
crossref pdf
Sy, O., Bosland, P. W. and Steiner, R. 2005. Inheritance of Phytophthora stem blight resistance as compared to Phytophthora root rot and Phytophthora foliar blight resistance in Capsicum annuum L. J. Am. Soc. Hortic. Sci. 130:75-78.
crossref
Sy, O., Steiner, R. and Bosland, P. W. 2008. Recombinant inbred line differential identifies race-specific resistance to Phytophthora root rot in Capsicum annuum. Phytopathology 98:867-870.
crossref pmid
Tabor, R. J. and Bunting, R. H. 1923. On a disease of cocoa and coffee fruits caused by a fungus hitherto undescribed. Ann. Bot. 37:153-157.
crossref
Thabuis, A., Lefebvre, V., Bernard, G., Daubèze, A. M., Phaly, T., Pochard, E. and Palloix, A. 2004. Phenotypic and molecular evaluation of a recurrent selection program for a polygenic resistance to Phytophthora capsici in pepper. Theor. Appl. Genet. 109:342-351.
crossref pmid pdf
Thambugala, K. M., Daranagama, D. A., Phillips, A. J. L., Kannangara, S. D. and Promputtha, I. 2020. Fungi vs. fungi in biocontrol: an overview of fungal antagonists applied against fungal plant pathogens. Front. Cell. Infect. Microbiol. 10:604923.
crossref pmid pmc
Thind, T. J. 2009. New generation fungicides. Center for Advanced Studies, (CAS) in Plant Pathology, New Delhi, India. pp. 148-150.
Thomas, J. and Suseela Bhai, R. 1995. Fungal and bacterial diseases of cardamom (Elettaria cardamomum Maton) and their management. J. Species Aromat. Crops 4:24-31.
Thomas, L., Gupta, A., Gopal, M., Chandra Mohanan, R., George, P. and Thomas, G. V. 2011. Evaluation of rhizospheric and endophytic Bacillus spp. and fluorescent Pseudomonas spp. isolated from Theobroma cacao L. for antagonistic reaction to Phytophthora palmivora, the causal organism of black pod disease of cocoa. J. Plant. Crops 39:370-376.
Thomas, L., Rajeev, P. and Dinesh, R. 2022. Cardamom. ICAR - Indian Institute of Spices Research Kozhikode, Kerala, India. pp. 32.
Thomas, L. M. and Naik, B. G. 2017. Survey for the incidence of foot rot of black pepper caused by Phytophthora capsici Leonian in Shivamogga and Chickmagaluru Districts of Karnataka State. Int. J. Pure Appl. Biosci. 5:293-298.
crossref
Trinh, T. H. T., Wang, S.-L., Nguyen, V. B., Tran, M. D., Doan, C. T., Vo, T. P. K., Huynh, Q. V. and Nguyen, A. D. 2019. A potent antifungal rhizobacteria Bacillus velezensis RB.DS29 isolated from black pepper (Piper nigrum L.). Res. Chem. Intermediates 45:5309-5323.
crossref pdf
Trzewik, A., Maciorowski, R. and Orlikowska, T. 2021. Pathogenicity of Phytophthora× alni isolates obtained from symptomatic trees, soil and water against alder. Forests 13:20.
crossref
Turner, R. S. 2005. After the famine: plant pathology, Phytophthora infestans, and the late blight of potatoes, 1845-1960. Hist. Stud. Phys. Biol. Sci. 35:341-370.
crossref pdf
Tyler, B. M. 2011. Entry of oomycete and fungal effectors into host cells. In: Effectors in plant-microbe interactions, eds. by F. Martin and S. Kamoun, pp. 243-275. Wiley-Blackwell, Oxford, UK.
crossref pdf
Vasanthi, H. R. and Parameswari, R. P. 2010. Indian spices for healthy heart: an overview. Curr. Cardiol. Rev. 6:274-279.
crossref pmid pmc
Vinod, K. K. 2011. Stress in plantation crops: adaptation and management. In: Crop stress and its management: perspectives and strategies, eds. by B. Venkateswarlu, A.K. Shanker, C. Shanker and M. Maheswari, pp. 45-137. Springer, New York, USA.
crossref pmid
Vithya, R. S., Gopal, K. S., Sujatha, V. S., Devi, K. M. D. and Girija, D. 2018. Abiotic stress tolerant Trichoderma harzianum strain for growth promotion and foot rot management in black pepper. J. Plant. Crops 46:32-43.
Waterhouse, G. M. 1963. Key to the species of Phytophthora de Bary. Mycol. Pap. 92:1-22.
Willits, D. A. and Sherwood, J. E. 1999. Polymerase chain reaction detection of Ustilago hordei in leaves of susceptible and resistant barley varieties. Phytopathology 89:212-217.
crossref pmid
Wu, L., Wu, H.-J., Qiao, J., Gao, X. and Borriss, R. 2015. Novel routes for improving biocontrol activity of Bacillus based bioinoculants. Front. Microbiol. 6:1395.
crossref pmid pmc
Yang, M-M, Xu, L-P, Xue, Q-Y, Yang, J-H, Xu, Q., Liu, H.-X. and Guo, J.-H. 2012. Screening potential bacterial biocontrol agents towards Phytophthora capsici in pepper. Eur. J. Plant Pathol. 134:811-820.
crossref pdf
Yuliar Nion, Y. A. and Toyota, K. 2015. Recent trends in control methods for bacterial wilt diseases caused by Ralstonia solanacearum. Microbes Environ. 30:1-11.
pmid pmc
Zhang, J., Zhu, F., Gu, M., Ye, H., Gu, L., Zhan, L., Liu, C., Yan, C. and Feng, G. 2021. Inhibitory activity and action mechanism of coumoxystrobin against Phytophthora litchii, which causes litchi fruit downy blight. Postharvest Biol. Technol. 181:111675.
crossref
Zhong, C., Li, Y., Sun, S., Duan, C. and Zhu, Z. 2019. Genetic mapping and molecular characterization of a broad-spectrum Phytophthora sojae resistance gene in Chinese soybean. Int. J. Mol. Sci. 20:1809.
crossref pmid pmc
TOOLS
METRICS Graph View
  • 5 Web of Science
  • 5 Crossref
  •  0 Scopus
  • 7,268 View
  • 216 Download
ORCID iDs

Krishnan Kalpana
https://orcid.org/0000-0002-8609-8429

Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next