Plant Pathol J > Volume 35(6); 2019 > Article
Lim, Kim, Choi, Luan, and Lee: The Shaker Type Potassium Channel, GORK, Regulates Abscisic Acid Signaling in Arabidopsis

Abstract

Evolution of adaptive mechanisms to abiotic stress is essential for plant growth and development. Plants adapt to stress conditions by activating the abscisic acid (ABA) signaling pathway. It has been suggested that the ABA receptor, clade A protein phosphatase, SnRK2 type kinase, and SLAC1 anion channel are important components of the ABA signaling pathway. In this study, we report that the shaker type potassium (K+) channel, GORK, modulates plant responses to ABA and abiotic stresses. Our results indicate that the full length of PP2CA is needed to interact with the GORK C-terminal region. We identified a loss of function allele in gork that displayed ABA-hyposensitive phenotype. gork and pp2ca mutants showed opposite responses to ABA in seed germination and seedling growth. Additionally, gork mutant was tolerant to the NaCl and mannitol treatments, whereas pp2ca mutant was sensitive to the NaCl and mannitol treatments. Thus, our results indicate that GORK enhances the sensitivity to ABA and negatively regulates the mechanisms involved in high salinity and osmotic stresses via PP2CA-mediated signals.

Global warming and extreme temperatures caused by climate change lead to stress conditions that interfere with plant growth and crop productivity. Plants have been constantly evolving defense mechanisms to overcome these stress conditions, such as high temperatures, drought, high salinity, and cold. Osmotic stress, caused by water deficits, also affects plant growth and causes reduced crop yields. Among osmotic stresses, drought stress is closely related to stomatal adjustment and is one of the major abiotic stresses (Golldack et al., 2014; Lee and Luan, 2012). When plants are exposed to drought conditions, closure of stomata in response to abscisic acid (ABA) occurs to minimize water loss (Golldack et al., 2014; Lee and Luan, 2012).
ABA is a key hormone in plant responses to abiotic stress, especially drought stress (Osakabe et al., 2014), as it modulates several stress-related genes, including protein kinases, phosphatases, transcription factors, and ion channels involved in osmotic adjustment (Sirichandra et al., 2009). However, although previous studies have elucidated aspects of the ABA signaling pathway from the perspective of plant cells, the exact mechanism of the ABA signaling pathway remains unclear (Lee et al., 2009; Lim et al., 2015a; Ma et al., 2009; Park et al., 2009). The three major components involved in ABA-induced stomatal closure are the pyrabactin resistance/pyrabactin resistance-like/regulatory component of ABA receptor (PYR/PYL/RCAR) proteins, sucrose non-fermenting 1-related subfamily 2 (SnRK2) protein kinases, and type 2C protein phosphatases (PP2Cs) (Lee and Luan, 2012; Ma et al., 2009; Park et al., 2009). PYR/PYL/RCAR ABA receptors initiate the ABA signaling pathway in cells and transfer the signal to clade A PP2Cs, which negatively modulate the ABA signaling pathway, and to SnRK2s protein kinases, which positively modulate the ABA signaling pathway (Lee and Luan, 2012). PYR/PYL/RCAR ABA receptors interact with clade A PP2Cs (Szostkiewicz et al., 2010), interrupting the interaction between clade A PP2Cs and SnRK2s. Released SnRK2 protein kinases enhance specific gene expression and activate ion channels and transcription factors via phosphorylation of target proteins (Lim et al., 2015a; Lee and Luan, 2012; Lee et al., 2009).
Additionally, ABA decreases the turgor pressure in guard cells by modifying the activities of several ion channels (Schroeder et al., 2001). SLAC1 and shaker type K+ channels are ABA-modulated ion channels that regulate anion and cation fluxes across the plasma membrane and tonoplast, which adjusts stomatal apertures (Lebaudy et al., 2010; Lemtiri-Chlieh and MacRobbie, 1994; Negi et al., 2008; Schroeder and Hagiwara, 1989; Schroeder et al., 1987; Vahisalu et al., 2008). In Arabidopsis, the shaker type K+ channel is a voltage-gated channel composed of nine genes (Hedrich, 2012). The structure of the shaker type K+ channel consists of six transmembrane domains and N-terminal/C-terminal regions in the cytoplasm. The C-terminal region is involved in protein-protein interactions and channel activity and targeting (Dreyer and Blatt, 2009; Nieves-Cordones et al., 2014; Pilot et al., 2003). Among the nine channels, KAT1, KAT2, AKT1, AKT2, and GORK are expressed in guard cells (Dreyer and Blatt, 2009; Lefoulon et al., 2016). It has been widely recognized that the anion efflux of SLAC1 activates GORK channels in guard cells, thus causing stomatal closure. Moreover, PP2C activity modulates stomatal aperture as it controls SLAC1 and GORK activity (Lefoulon et al., 2016).
Moreover, studies have reported that the RCAR2 ABA receptor positively regulates the ABA signaling pathway, whereas the clade A protein phosphatase PP2CA negatively regulates the ABA signaling pathway by modulating the SLAC1 anion channel activity (Lee et al., 2009, 2013). Additionally, these studies have also demonstrated that RCAR2 is associated with drought tolerance. In this study, we isolated the Arabidopsis GROK channel that interacts with PP2CA; we also isolated two T-DNA insertion mutants of GORK1 that are hyposensitive to ABA, high salinity, and osmotic stress in seeds and seedlings. Our findings indicate that GORK channels modulate ABA-induced stress responses.

Materials and Methods

Plant growth conditions

Seeds of Arabidopsis (Arabidopsis thaliana, ecotype Col-0) were grown in soil composed of equal parts of sterilized sand, loam soil, and a compost mixture of peat moss, perlite, and vermiculite (5:3:2, v/v/v). Seeds were grown under white fluorescent light (130 μmol photons/m2/s) at 24 ± 1°C. For the germination and seedling growth experiment, Arabidopsis seeds were grown on Murashige and Skoog (MS) media (Duchefa Biochemie, Haarlem, Netherlands) supplemented with 1% sucrose in a growth chamber at 24 ± 1°C and under a 16-h light/8-h dark period. Seeds were vernalized at 4°C for 2 days to synchronize germination.

Germination and seedling growth

To examine germination, primary root growth, and cotyledon greening, 200 seeds of wild-type plants, gork and pp2ca mutant plants were plated on MS agar medium containing ABA, NaCl, and mannitol. Germination was determined by radicle emergence. Primary root growth was measured 7 days after plating, and green cotyledons were measured 10 days after plating. Plates were placed in a growth chamber at 24°C for a 16-h light/8-h dark cycle.

RNA isolation and reverse transcription PCR (RT-PCR) analysis

Total RNA isolation and RT-PCR assays were conducted as described by Lim et al. (2015b), using leaf tissues of wild-type and gork mutant plants. To synthesize cDNA, we used 1 μg of the total RNA and a Transcript First Strand cDNA Synthesis kit (Roche, Indianapolis, IN, USA), according to the manufacturer’s protocol. For the RT-PCR assay, the cDNA was amplified using the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) with GORK specific primers (F: CAGGAAACTTCCTTTGCACGAC; R: TCAAATGAATCATCGGAAAAATC). The AtACT8 gene was used for internal control.

Subcellular localization of GORK and PP2CA

For the subcellular localization analysis, we used full-length coding regions of GORK and PP2CA without the stop codon and p326GFP vector. To express each transient construct, Agrobacterium tumefaciens strain GV3101 was infiltrated to epidermal cells of Nicotiana benthamiana p19 strain (1:1 ratio; OD600 = 0.5). Four days after such transient expression, tobacco leaves were cut and epidermal cells were observed with a confocal microscope (510 UV/Vis Meta, Zeiss, Oberkochen, Germany).

Yeast two-hybrid analysis

To verify the interaction between GORK and PP2CA, we used a yeast two-hybrid (Y2H) analysis (Lee et al., 2007). The C-terminal region of GORK and the full-length cDNA of PP2CA were inserted into pGBKT7 and pGADT7 vectors, respectively, and transformed into the AH109 yeast strain using the lithium acetate-mediated method (Ito et al., 1983). To evaluate the interaction between GORK and PP2CA, yeast cells containing each construct were spotted on selection media (SC-adenine-histidine-leucine-tryptophan) and grown for 4 days.

Bimolecular fluorescence complementation (BiFC) analysis

BiFC analysis was conducted as described previously (Lim and Lee, 2016). To generate BiFC constructs, open reading frames without a stop codon for GORK and PP2CA were inserted into Pro35S:SPYNE and Pro35S:SPYCE vectors, respectively (Waadt et al., 2008). To express each transient construct, Agrobacterium tumefaciens strain GV3101 was infiltrated into epidermal cells of N. benthamiana (OD600 = 0.5). Four days after agroinfiltration, tobacco leaves were cut and epidermal cells were observed with a confocal microscope (510 UV/Vis Meta, Zeiss).

Results and Discussion

Reduced sensitivity of gork mutants in response to ABA

Previous studies have shown that GORK is involved in stomatal closure and water loss by transpiration (Hosy et al., 2003; Lefoulon et al., 2016). Even though it is widely recognized that clade A PP2Cs negatively modulates GORK channel activity and that CPK3 positively modulates GORK channel activity (Corratgé-Faillie et al., 2017; Lefoulon et al., 2016), the biological role of GORK in early stages of a plant’s life cycle remains unclear. To investigate the biological functions of GORK in seeds and seedlings, we identified T-DNA insertion mutants gork-1 (SALK_082258) and gork-2 (SALK_144737) as knockout alleles (Fig. 1A). First, we performed RT-PCR analysis to verify the knockout of gork mutants (Fig. 1B). GORK transcripts were detected in wild-type plants but not in gork mutants. The identified gork mutants showed no obvious phenotype under normal growth conditions (Fig. 1C). However, growth of wild-type and gork mutant plants was inhibited in the presence of 0.5 and 0.8 μM of ABA. Additionally, primary root lengths of gork mutants were significantly longer than that of wild-type plants (Fig. 1C and D).

Interaction between GORK and PP2CA

Earlier, we demonstrated that PP2CA inhibits the activity of SnRK2.6 kinase, which consequently inhibits the SLAC1 anion channel (Lee et al., 2009, 2013). We conducted a Y2H assay to isolate the clade A PP2C interacting with GORK. We used the GORK C-terminal region as bait and clade A PP2Cs as prey. We performed a one-by-one Y2H assay with clade A PP2Cs (Fig. 2A); specifically, the yeast with GORK and PP2CA grew on the selective media, suggesting that GORK interacts with PP2CA. It has been demonstrated that the domain of clade A PP2Cs, including specific amino acids, plays an important role in the interaction with RCARs and SnRK2 kinases (Fuchs et al., 2013); however, little is known about the interaction with GORK. To elucidate which domain is important in the interaction between GORK and PP2CA, we generated truncated forms of PP2CA and performed Y2H. Growth of yeast with GORK was only detected with full-length PP2CA (Fig. 2B), indicating that full-length PP2CA is necessary for the interaction to occur. We used BiFC analysis to determine where the interaction complex was located inside the cell and green fluorescent protein (GFP) analysis to determine where each protein was located inside the cell (Fig. 2C). Co-expression of GORK-SPYNE with PP2CA-SPYCE was detected as yellow fluorescence predominantly in plasma membrane. The GFP signals of GORK-GFP and PP2CA-GFP were generated in the plasma membrane and nucleus, respectively. Such results agree with the Y2H analysis and indicate a physical interaction between GORK and PP2CA. In addition, it also suggests that GORK and PP2CA are both targeted at the plasma membrane, where they regulate K+ efflux thus causing stomatal closure (Corratgé-Faillie et al., 2017; Lefoulon et al., 2016).

ABA sensitivity of GORK and PP2CA mutants

PP2CA has been reported as one of the core ABA signaling component, where it acts as a negative ABA regulator (Baek et al., 2018; Lee et al., 2013; Lim et al., 2015a). To investigate the in vivo function of GORK in response to ABA, we compared the germination and seedling growth of wild-type plants, gork and pp2ca mutant plants (Fig. 3). In the absence of exogenous ABA, we did not find differences between the phenotypes in relation to seed germination and seedling development. However, when grown on media containing ABA, gork mutants showed significantly higher germination in comparison to wild-type plants, whereas pp2ca mutants showed significantly lower germination rate than wild-type plants (Fig. 3A). We also compared primary root growth and seedling establishment of wild-type, gork, and pp2ca mutant plants (Fig. 3B-D). ABA-induced inhibition of primary root growth in gork mutants was significantly lower in comparison to wild-type and pp2ca plants (Fig. 3B). Additionally, the number of green cotyledons in gork mutant plants was significantly higher in comparison to wild-type plants; whereas in pp2ca mutants, the number of green cotyledons was significantly lower in comparison to wild-type plants (Fig. 3C and D). These results suggest that knockout of GORK decreases sensitivity to ABA during germination, which leads to reduced primary root growth and hinders seedling establishment.

Abiotic stress responses of gork and pp2ca mutants

ABA signal and the abiotic stress response share common signaling components (Lim et al., 2015a; Sah et al., 2016). We therefore investigated the involvement of GORK and PP2CA in plant responses to abiotic stress, including high salinity and osmotic stress (Figs. 4 and 5). First, we evaluated the plants response to high salinity by comparing different phenotypes (wild-type, gork and pp2ca mutant plants) treated with NaCl (Fig. 4). Under regular growth conditions, there was no significant difference between wild-type and mutant plants. However, in the presence of NaCl, pp2ca mutants showed significantly lower germination rate compared to wild-type and gork plants (Fig. 4A). Moreover, the number of green cotyledons was significantly higher in gork mutant plants and significantly lower in pp2ca mutant plants in comparison to wild-type plants (Fig. 4B and C).
To further examine whether gork and pp2ca mutants showed different responses to osmotic stress, we measured germination and the number of green cotyledons in seeds treated with mannitol (Fig. 5). In contrast to the ABA and NaCl treatments, seed germination of gork and pp2ca mutants did not differ from that of wild-type plants (Fig. 5A). However, the number of green cotyledons was significantly higher in gork mutants and significantly lower in pp2ca mutants in comparison to the number of green cotyledons found on wild-type plants (Fig. 5B and C). These results indicate that both GORK and PP2CA affect the plant responses to high salinity and osmotic stress. Together, these results are consistent with earlier studies and with the genetic analyses performed. In conclusion, the shaker type K+ channel GORK is related to the ABA response as it interacts with clade A PP2C, affecting the plant’s response to high salinity and osmotic stress. However, gork mutants do not appear to be related in regulating turgor pressure in guard cells in germination and seedling growth. Identification of additional regulators of GORK, such as other kinases or phosphatases, will help clarify the exact functions of GORK in the ABA signaling pathway in seeds and seedlings.

Acknowledgments

This work was supported by a grant from the “Next-Generation BioGreen 21 Program for Agriculture & Technology Development (Project No. PJ01367603),” Rural Development Administration, and by the National Research Foundation of Korea (NRF) grant funded by the Korea Government (MSIT) (No. 2017R1D1A1B03031961), Republic of Korea.

Fig. 1
Decreased sensitivity of gork mutants to abscisic acid (ABA). (A) Schematic diagram of the T-DNA insertion sites within the genomic DNA sequence of the GORK gene. Boxes refer to exons and bars to introns. (B) Relative expression of the GORK gene in wild-type (WT) and gork mutant plants. (C, D) Inhibition of primary root growth of WT and gork mutant plants in the presence of ABA. Seedlings were grown vertically in 0.5× Murashige and Skoog containing 0.5 and 0.8 μM ABA. After 12 days, images were taken (C) and root lengths of each plant were measured (D). Data represent the mean ± SE of three independent experiments. Different letters indicate significant difference between WT and mutant plants (ANOVA; P < 0.05).
ppj-35-684f1.gif
Fig. 2
Physical interactions between GORK and PP2CA. (A) Yeast-2 hybrid (Y2H) assay of the interactions between GORK and PP2Cs. Growth on SC-ALTW was used as an indicator of the interaction (left row). Growth on SC-LW was used as the control (right row). (B) Y2H assay of the interactions between GORK and PP2CA fragment domains. (C) Bimolecular fluorescence complementation assay of the interaction between GORK and PP2CA and their subcellular location in leaves of Nicotiana benthamiana. The yellow fluorescence indicates an interaction between the indicated partner proteins. The images were obtained from the YFP channel, bright field, or a merged picture of the two. Scale bars = 20 μm.
ppj-35-684f2.gif
Fig. 3
Abscisic acid (ABA) sensitivity of gork and pp2ca mutants. (A) Germination of wild-type (WT), gork and pp2ca mutant plants on 0.5× Murashige and Skoog (MS) media containing different concentrations of ABA. Germination was determined by radicle emergence and was counted 3 days after plating. (B) Inhibition of primary root growth by ABA in WT, gork, and pp2ca mutant plants. Seedlings were grown vertically in 0.5× MS containing 0.75 μM of ABA for 7 days. (C, D) Number of green cotyledons in WT, gork, and pp2ca mutant plants in response to ABA. Representative photographs were taken at 10 days after plating (C), and the number of seedlings with expanded cotyledons was counted (D). Values are the mean ± SE from three independent experiments. Different letters indicate significant difference between WT and mutant plants (ANOVA; P < 0.05).
ppj-35-684f3.gif
Fig. 4
Response of gork and pp2ca mutant plants to NaCl. (A) Germination rates of wild-type (WT), gork, and pp2ca mutant plants on 0.5× Murashige and Skoog (MS) media containing 200 mM of NaCl. Germination was determined by radicle emergence and was evaluated 9 days after plating. (B, C) Number of green cotyledon in WT, gork, and pp2ca mutant plants in response to NaCl. Representative photographs were taken at 10 days after plating (B), and the number of seedlings with expanded cotyledons was counted (C). Values are the mean ± SE from three independent experiments. Different letters indicate significant difference between WT and mutant plants (ANOVA, P < 0.05).
ppj-35-684f4.gif
Fig. 5
Response of gork and pp2ca mutant plants to mannitol. (A) Germination rates of wild-type (WT), gork, and pp2ca mutant plants on 0.5× Murashige and Skoog media containing 400 mM of mannitol. Germination was determined by radicle emergence and was evaluated 9 days after plating. (B, C) Number of green cotyledons in WT, gork, and pp2ca mutant plants in response to mannitol. Representative photographs were taken at 10 days after plating (B), and the number of seedlings with expanded cotyledons was counted (C). Values are the mean ± SE from three independent experiments. Different letters indicate significant difference between WT and mutant plants (ANOVA; P < 0.05).
ppj-35-684f5.gif

References

Baek, W, Lim, CW and Lee, SC 2018. A DEAD-box RNA helicase, RH8, is critical for regulation of ABA signalling and the drought stress response via inhibition of PP2CA activity. Plant Cell Environ. 41:1593-1604.
crossref pmid
Corratgé-Faillie, C, Ronzier, E, Sanchez, F, Prado, K, Kim, J-H, Lanciano, S, Leonhardt, N, Lacombe, B and Xiong, TC 2017. The Arabidopsis guard cell outward potassium channel GORK is regulated by CPK33. FEBS Lett. 591:1982-1992.
crossref pmid
Dreyer, I and Blatt, MR 2009. What makes a gate? The ins and outs of Kv-like K+ channels in plants. Trends Plant Sci. 14:383-390.
crossref pmid
Fuchs, S, Grill, E, Meskiene, I and Schweighofer, A 2013. Type 2C protein phosphatases in plants. FEBS J. 280:681-693.
crossref pmid
Golldack, D, Li, C, Mohan, H and Probst, N 2014. Tolerance to drought and salt stress in plants: unraveling the signaling networks. Front Plant Sci. 5:151
crossref pmid pmc
Hedrich, R 2012. Ion channels in plants. Physiol Rev. 92:1777-1811.
crossref pmid
Hosy, E, Vavasseur, A, Mouline, K, Dreyer, I, Gaymard, F, Porée, F, Boucherez, J, Lebaudy, A, Bouchez, D, Very, A-A, Simonneau, T, Thibaud, J-B and Sentenac, H 2003. The Arabidopsis outward K+ channel GORK is involved in regulation of stomatal movements and plant transpiration. Proc Natl Acad Sci U S A. 100:5549-5554.
crossref pmid pmc
Ito, H, Fukuda, Y, Murata, K and Kimura, A 1983. Transformation of intact yeast cells treated with alkali cations. J Bacteriol. 153:163-168.
crossref pmid pmc
Lebaudy, A, Pascaud, F, Véry, A-A, Alcon, C, Dreyer, I, Thibaud, J-B and Lacombe, B 2010. Preferential KAT1-KAT2 heteromerization determines inward K+ current properties in Arabidopsis guard cells. J Biol Chem. 285:6265-6274.
crossref pmid
Lee, SC, Lan, W, Buchanan, BB and Luan, S 2009. A protein kinase-phosphatase pair interacts with an ion channel to regulate ABA signaling in plant guard cells. Proc Natl Acad Sci U S A. 106:21419-21424.
crossref pmid pmc
Lee, SC, Lan, W-Z, Kim, B-G, Li, L, Cheong, YH, Pandey, GK, Lu, G, Buchanan, BB and Luan, S 2007. A protein phosphorylation/dephosphorylation network regulates a plant potassium channel. Proc Natl Acad Sci U S A. 104:15959-15964.
crossref pmid pmc
Lee, SC, Lim, CW, Lan, W, He, K and Luan, S 2013. ABA signaling in guard cells entails a dynamic protein-protein interaction relay from the PYL-RCAR family receptors to ion channels. Mol Plant. 6:528-538.
crossref pmid
Lee, SC and Luan, S 2012. ABA signal transduction at the crossroad of biotic and abiotic stress responses. Plant Cell Environ. 35:53-60.
crossref pmid
Lefoulon, C, Boeglin, M, Moreau, B, Véry, A-A, Szponarski, W, Dauzat, M, Michard, E, Gaillard, I and Chérel, I 2016. The Arabidopsis AtPP2CA protein phosphatase inhibits the GORK K+ efflux channel and exerts a dominant suppressive effect on phosphomimetic-activating mutations. J Biol Chem. 291:6521-6533.
crossref pmid pmc
Lemtiri-Chlieh, F and MacRobbie, EA 1994. Role of calcium in the modulation of Vicia guard cell potassium channels by abscisic acid: a patch-clamp study. J Membr Biol. 137:99-107.
crossref pmid
Lim, CW, Baek, W, Jung, J, Kim, J-H and Lee, SC 2015a. Function of ABA in stomatal defense against biotic and drought stresses. Int J Mol Sci. 16:15251-15270.
crossref pmid
Lim, CW, Hwang, BK and Lee, SC 2015b. Functional roles of the pepper RING finger protein gene, CaRING1, in abscisic acid signaling and dehydration tolerance. Plant Mol Biol. 89:143-156.
crossref pmid
Lim, CW and Lee, SC 2016. Pepper protein phosphatase type 2C, CaADIP1 and its interacting partner CaRLP1 antagonistically regulate ABA signalling and drought response. Plant Cell Environ. 39:1559-1575.
crossref pmid
Ma, Y, Szostkiewicz, I, Korte, A, Moes, D, Yang, Y, Christmann, A and Grill, E 2009. Regulators of PP2C phosphatase activity function as abscisic acid sensors. Science. 324:1064-1068.
crossref pmid
Negi, J, Matsuda, O, Nagasawa, T, Oba, Y, Takahashi, H, Kawai-Yamada, M, Uchimiya, H, Hashimoto, M and Iba, K 2008. CO2 regulator SLAC1 and its homologues are essential for anion homeostasis in plant cells. Nature. 452:483-486.
crossref pmid
Nieves-Cordones, M, Chavanieu, A, Jeanguenin, L, Alcon, C, Szponarski, W, Estaran, S, Chérel, I, Zimmermann, S, Sentenac, H and Gaillard, I 2014. Distinct amino acids in the C-linker domain of the Arabidopsis K+ channel KAT2 determine its subcellular localization and activity at the plasma membrane. Plant Physiol. 164:1415-1429.
crossref pmid pmc
Osakabe, Y, Osakabe, K, Shinozaki, K and Tran, L-S 2014. Response of plants to water stress. Front Plant Sci. 5:86
crossref pmid pmc
Park, S-Y, Fung, P, Nishimura, N, Jensen, DR, Fujii, H, Zhao, Y, Lumba, S, Santiago, J, Rodrigues, A, Chow, T-FF, Alfred, SE, Bonetta, D, Finkelstein, R, Provart, NJ, Desveaux, D, Rodriguez, PL, McCourt, P, Zhu, J-K, Schroeder, JI, Volkman, BF and Cutler, SR 2009. Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science. 324:1068-1071.
crossref pmid pmc
Pilot, G, Pratelli, R, Gaymard, F, Meyer, Y and Sentenac, H 2003. Five-group distribution of the Shaker-like K+ channel family in higher plants. J Mol Evol. 56:418-434.
crossref pmid
Sah, SK, Reddy, KR and Li, J 2016. Abscisic acid and abiotic stress tolerance in crop plants. Front Plant Sci. 7:571
crossref pmid pmc
Schroeder, JI and Hagiwara, S 1989. Cytosolic calcium regulates ion channels in the plasma membrane of Vicia faba guard cells. Nature. 338:427-430.
crossref
Schroeder, JI, Kwak, JM and Allen, GJ 2001. Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature. 410:327-330.
crossref pmid
Schroeder, JI, Raschke, K and Neher, E 1987. Voltage dependence of K+ channels in guard-cell protoplasts. Proc Natl Acad Sci U S A. 84:4108-4112.
crossref pmid pmc
Sirichandra, C, Wasilewska, A, Vlad, F, Valon, C and Leung, J 2009. The guard cell as a single-cell model towards understanding drought tolerance and abscisic acid action. J Exp Bot. 60:1439-1463.
crossref pmid
Szostkiewicz, I, Richter, K, Kepka, M, Demmel, S, Ma, Y, Korte, A, Assaad, FF, Christmann, A and Grill, E 2010. Closely related receptor complexes differ in their ABA selectivity and sensitivity. Plant J. 61:25-35.
crossref pmid
Vahisalu, T, Kollist, H, Wang, Y-F, Nishimura, N, Chan, W-Y, Valerio, G, Lamminmäki, A, Brosché, M, Moldau, H, Desikan, R, Schroeder, JI and Kangasjärvi, J 2008. SLAC1 is required for plant guard cell S-type anion channel function in stomatal signalling. Nature. 452:487-491.
crossref pmid pmc
Waadt, R, Schmidt, LK, Lohse, M, Hashimoto, K, Bock, R and Kudla, J 2008. Multicolor bimolecular fluorescence complementation reveals simultaneous formation of alternative CBL/CIPK complexes in planta. Plant J. 56:505-516.
crossref pmid
TOOLS
METRICS Graph View
  • 6 Web of Science
  • 7 Crossref
  •  0 Scopus
  • 3,128 View
  • 51 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2024 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next