Plant Pathol J > Volume 29(4); 2013 > Article
Kwak, Kim, Lee, Seo, Kim, Kim, Cha, and Choi: Molecular Characterization and Variation of the Broad bean wilt virus 2 Isolates Based on Analyses of Complete Genome Sequences

Abstract

The full-genome sequences of fourteen isolates of Broad bean wilt virus 2 (BBWV2), collected from broad bean, pea, spinach, bell pepper and paprika plants in Korea during the years 2006-2012, were determined and analyzed comparatively along with fifteen previously reported BBWV2 genome sequences. Sequence analyses showed that RNA-1 and RNA-2 sequences of BBWV2 Korean isolates consisted of 5950-5956 and 3568-3604 nucleotides, respectively. Full-length genome sequence-based phylogenetic analyses revealed that the BBWV2 Korean isolates could be divided into three major groups comprising GS-I (isolates BB2 and RP7) along with isolate IP, GS-II (isolates BB5, P2, P3 and RP3) along with isolate B935, and GS-III including 16 BBWV2 Korean isolates. Interestingly, GS-III appears to be newly emerged and predominant in Korea. Recombination analyses identified two recombination events in the analyzed BBWV2 population: one in the RNA-1 of isolate K and another one in the RNA-2 of isolate XJ14-3. However, no recombination events were detected in the other 21 Korean isolates. On the other hand, out of 29 BBWV2 isolates, 16 isolates were found to be reassortants, of which each RNA segment (i.e. RNA1 and RNA2) was originated from different parental isolates. Our findings suggested that reassortment rather than recombination is a major evolutionary force in the genetic diversification of BBWV population in Korea.

Broad bean wilt virus (BBWV) is a destructive pathogen in many economically important horticultural and ornamental crops. BBWV is the type species of the genus Fabavirus in the family Secoviridae (Taylor et al., 1972). It is transmitted by aphids, mostly Aphis gossypii and Myzus persicae, with infection rate of 60-90% in a nonpersistent manner and has a wide host range (Benner et al., 1985; Brunt et al., 1996). By serological and molecular studies, BBWV isolates are classified into two species, Broad bean wilt virus 1 (BBWV1) and Broad bean wilt virus 2 (BBWV2) (Kobayashi et al., 2003; Uyemoto et al., 1974). Although they show the similar genome structures and functions, the nucleotide (nt) sequence identity between the two BBWV species was limited (39%-67%). The genome is composed of two single stranded positive-sense RNA molecules, RNA-1 and RNA-2, that are encapsidated separately into icosahedral virions (Lisa et al., 1996). While BBWV1 has been reported mainly in Europe and North America, BBWV2 has a worldwide distribution. In Korea, BBWV1 has not been detected yet, but disease incidences caused by BBWV2 was reported firstly by Lee et al. (1979).
BBWV2 RNA-1 and RNA-2 are approximately 6 kb and 4 kb nucleotides (nt) in length, respectively, and each RNA segment contains a single open reading frame (ORF), and thus is translated into a single polyprotein precursor which is further processed by proteolytic cleavage to yield functional proteins. RNA-1 encodes five proteins including cofactor protease (Co-Pro), NTP-binding motif (NTBM), genome-linked viral protein (VPg), protease (Pro) and RNA-dependent RNA polymerase (RdRp) while RNA2 encodes three proteins including movement protein (MP), large coat protein (LCP), and small coat protein (SCP) (Goldbach et al., 1995). So far, the complete nt sequences of eight BBWV2 isolates (Ikegami et al., 1998; 2001; Kobayashi et al., 1999; Koh et al., 2001; Kuroda et al., 2000; Lee et al., 2000; Nakamura et al., 1998; Qi et al., 2000a; 2000b) and partial sequences of twenty-five BBWV2 isolates (Ferrer et al., 2011; Kobayashi et al., 1999; 2004; Kondo et al., 2005; Sui et al., 2009) from various host plants have been reported.
In Korea, natural infections of BBWV2 on red pepper (Lee et al., 2000), broad bean (unpublished), pea (Choi et al., 2001), spinach (Lee et al., 1979), perilla (Choi et al., 2001), lily (Chang et al., 1987), Gentiana spp. (Roh et al, 1998), gladiolus (Park, et al. 1998), and celery (Hahm, et al., 1998) have been reported. In present, disease caused by BBWV2 has increased gradually in pepper plants, i.e. red pepper (Cho et al., 2007), bell pepper, and paprika (Ryu et al., 2009). Nevertheless, molecular characterization of BBWV2 Korean isolates (except K isolate) has not been studied. Recently, we characterized seven BBWV2 isolates obtained from red pepper (Kwak et al., 2013). In this study, we determined complete genome sequences of fourteen BBWV2 isolates collected from various plants including broad bean, pea, spinach, bell pepper, and paprika around the Korean Peninsula during the years 2006-2012. We further analyzed molecular characteristics and genetic structure of BBWV2 Korean isolates in comparison with the previously reported isolates using a range of methods to understand their evolutionary relationships.

Materials and Methods

Isolates collection

Twenty-one BBWV2 isolates were collected from 6 natural plants in different areas in Korea during the year 2006-2012 based on the symptoms on leaves and fruits. Out of 21 BBWV2 isolates, 3 isolates (BB2, BB5 and BB9) were collected from broad bean (Vicia faba), 2 isolates (P2 and P3) from pea (Pisum sativum), 3 isolates (SP, SP1 and SP2) from spinach (Spinacia oleracea), 7 isolates (RP1, RP2, RP3, RP4, RP5, RP6 and RP7) from red pepper (Capsicum annuum L.), 3 isolates (GP2, GP4 and GP5) from bell pepper (C. annuum var. gulosum), and 3 isolates (PAP1, PAP2 and PAP3) from paprika (C. annuum var. gulosum) (Table 1, Fig. 1). Virus isolates were inoculated to local lesion host, Chenopodium quinoa, reisolated from local lesions at least three times in succession, and propagated in Nicotiana benthamiana.

RT-PCR, cloning and sequencing

Total RNAs were extracted from infected leaf samples by easy-spin total RNA extraction kit (iNtRON, Korea) according to the manufacturer’s instructions. RT-PCR was carried out two-steps procedure including RT using AMV reverse transcriptase (Promega, USA) and PCR using LA taq polymerase (TAKARA, Japan). Primer pairs for full-length nt sequence were designed group-specifically for RNA-1 and universally for RNA-2 (Table 2). End sequences of each RNA segment were obtained with the 5′ and 3′ rapid amplification of cDNA ends (RACE) protocol (BM, Germany). cDNA clones containing the 5′ end of the genomes were obtained using Xec primers (5′-AAAGAATTCCCCCCCC CCCCC-3′), and BBWV2 5′-RNA1 (5′-GCCATYTCAT TGGCATGGAAAAAGC-3′) and BBWV2 5′-RNA2 (5′-GAAGGGTGCAACGATATATGCAAATTC-3′) primers complementary to nt 384-360 and 424-395, respectively, of BBWV2 stain. In addition, cDNA clones containing the 3′ end of the genomes were obtained using BBWV2 3′-RNA1 (5′-AGGCATATGAGAGAGGAGAG-3′) and BBWV2 3′-RNA2 (5′-GAAATGGGGAATGTTCATGAGTA-3′) primers complementary to nt 5646-5665 and 3269-3291, respectively, and anchor primers (5′-GACCACGCGTATCGAT GTCGACTTTTTTTTTTTTTTTTV-3′). RT-PCR amplified DNA fragments were purified using MEGA quick-spin™ Kit (iNtRON, Korea) and cloned into pGEM-T easy vector (Promega, USA) according to the manufacturer’s instructions followed by transformation into E. coli DH5α strain. Sequencing was done by a commercial company (Genotech, Korea). The resultant sequences were assembled using DNA Star v. 5.02 and have been submitted to GenBank database with accession numbers listed in Table 1.

Sequence and phylogenetic analyses

The complete nt sequences and the deduced amino acid sequences were aligned using Geneious method and ClustalW method in Geneious pro 5 and compared with the previously reported isolates, e.g. IP (Japan, Kobayashi et al., 1999) and ME (Singarpore, Koh et al., 2001) isolates for Group I and IA (Japan, Kuroda et al., 2000), K (Korea, Lee et al., 2000), B935 (China, Qi et al., 2000a; 2000b), MB7 (Japan, Nakamura et al., 1998), XJ14-3 (China, unpublished) isolates and PatMMV (Japan, Ikegami et al., 1998; Ikegami et al., 2001) for Group II and with BBWV1 isolates, PV132 and Ben as outgroup (Table 3). Phylogenetic analyses were performed employing maximum likelihood method implemented in the MEGA 5 (Tamura et al., 2011). All phylogeny tests were done by using the best substitution model for nucleotides/amino acids and 1,000 bootstrap replicates.

Recombination and ressortment analysis

Detection of recombination between 29 BBWV2 isolates was processed by RDP3 program (Recombination Detection Program, ver. 3). The previously saved mega format files which aligning sequences of 29 BBWV2 RNA-1 and RNA-2 segments were opened by RDP3. Then the detection of recombination among those segments, between all RNA-1 segments each, between all RNA-2 segments each and between RNA-1 and -2 each other. Used methods of recombination detections are RDP, GENECONV, BOOTSCAN, MaxChi, Chimaera, and SISCAN methods implemented in the RDP3 program. Parameter was set to default options following the manufacture’s recommendation. Then recombination events were computed with highest acceptable P-Value set to 0.01.

Results

Genome characterization of BBWV2 Korean isolates

To investigate the genetic diversity of BBWV2 Korean isolates, twenty-one BBWV2 isolates were collected from 6 natural plants (broad bean, pea, spinach, red pepper, bell pepper, and paprika) in 10 areas during the years 2006-2012: The full-genome sequences of 7 isolates from red pepper from our previous study (Kwak et al., 2013) along with full-genome sequences of 14 additional isolates determined in this study were summarized in Table 1. The representative symptoms include severe mosaic, vein clearing, stunting on the infected leaves and irregularly shaped coloring, chlorotic spot, and mosaic on the infected fruits (Fig. 2). The RNA-1 segment of BBWV2 Korean isolates consisted of 5950 to 5956 nt encoding 5 mature proteins including Co-pro (353 or 354 amino acids depending on subgroups), NTBM (582 amino acids), VPg (26 amino acids), Pro (209 amino acids), and RdRp (699 amino acids). The RNA-2 segment consisted of 3568 to 3604 nt encoding 3 mature proteins including MP (465 amino acids), LCP (402 amino acids), and SCP (197 amino acids). The sequences are available in the GenBank database with accession numbers listed in Table 1.

Phylogenetic relationship analysis

The complete nt and deduced amino acid sequences of 21 BBWV2 Korean isolates were analyzed by comparing with eight previously reported BBWV2 isolates (IP, IA, ME, MB7, K, PatMMV, B935, and XJ14-3). Two BBWV1 isolates (PV132 and Ben) were included as outgroup isolates in the phylogenetic analyses. Phylogenetic trees reconstructed using the complete nt sequences revealed that BBWV2 Korean isolates could be divided largely into two groups, Group I and Group II, in both RNA-1 and RNA-2 (Fig. 3). In addition, each group could be subgrouped according to the host plants and/or collected areas. Group I included two isolates (IP and ME) while Group II included six isolates (B935, IA, K, MB7, PatMMV and XJ114) for the RNA-1- and RNA-2-based phylogenetic trees (Fig. 3). For the RNA-1 segment of Korean isolates, four isolates (BB5, RP3, P2, and P3) were classified as Group II and the remains were classified as Group I. Meanwhile, the phylogenetic tree of the RNA-2 segment showed that two Korean isolates, BB2 and RP7, were classified as Group I and the remaining nineteen Korean isolates were classified as Group II. Furthermore, Group II of RNA-2 could be divided into 3 subgroups of II-a, II-b, and II-c. The nineteen Korean isolates, excluding BB2 and RP7, belonged to subgroup II-a along with the Chinese isolate B935.
The phylogenetic trees reconstructed based on the amino acid sequences of the mature proteins which are Co-Pro, NTBM, Pro, RdRp, LCP, and SCP, showed consistent grouping compared with the nucleotide sequence-based trees, but the trees of VPg and MP amino acids showed different patterns in grouping (Fig. 4). The BBWV2 VPg is composed of a short sequence of 26 amino acids and has little variation among isolates. Interestingly, the isolate K and Chinese isolate XJ14-3 were separately grouped in the trees reconstructed with the Co-Pro or MP amino acid sequences while these two isolates were most closely grouped in the RNA-2 nucleotide-based tree. The majority of RNA-1 genomes of the Korean isolates were grouped into Group I while their RNA-2 genomes were included in Group II. Thus, according to the group-combinations between RNA-1 and RNA-2 segments, BBWV2 could be designated as three genetic subpopulations of GS-I (both RNA-1 and RNA-2 genomes belong to Group I), GS-II (both RNA-1 and RNA-2 genomes belong to Group II) and GS-III (RNA-1 and RNA2 genomes belong to Group I and Group II, respectively). Based on this categorization, four isolates (BB2,RP7, IP, and ME) were classified to GS-I, nine isolates (BB5, P2, P3, RP3, B935, IA, MB7, PatMMV, K, and XJ14-3) to GS-II, and the other 15 Korean isolates (BB9, SP, SP1, SP2, RP1, RP2, RP4, RP5, RP6, PAP1, PAP2, PAP3, GP2, GP4, and GP5) to GS-III. The isolates belonging to GS-III have been detected newly and pre-dominantly in Korea.

Sequence comparison

The nucleotide and amino acid sequence identities between BBWV2 isolates were analyzed. The results are summarized in Table 4 and Table 5. For the nt sequences of RNA-1, BB2, which belonged to Group I, showed 98.5% and 96.5% nt sequence identities with SP2 and IP, respectively, which belonged to the same group (Fig. 3). On the other hand, BB2 exhibited 78.7% and 78.2 nt sequence identities with BB5 and K, respectively, which belonged to Group II. In the mean time, BB2 showed 62-63% nt sequence identity with the BBWV1 isolates (Table 4). For the nt sequence of RNA-2 segment, BB2 showed 90.9% and 91.4% nt sequence identities with RP7 and IP, respectively, while it exhibited 78-81% nt sequence identity with most of isolates in Group II (Table 5).
For the viral proteins encoded in RNA-1, the amino aicd sequence identities between BB2 (as a representative of the Group I isolates) and the Group II isolates were 70-75% for Co-Pro, 90-92% for NTBM, 92% for VPg, 92-93% for Pro, and 91-92% for RdRp. The amino acid identity between two groups for Co-Pro was lower than those of the other proteins. Indeed, the amino acid alignment showed that the Co-Pro region contains high amino acid variations among isolates (Fig. 5). For the viral proteins encoded in RNA-2, the amino acid sequence identities between BB2 and the Group II isolates were 85-88% for MP, 85-94% for LCP, and 90-94% for SCP. In addition, the nt sequence identities between BB2 and the Group II isolates for the 5 non-coding region (NCR) and 3 NCR of RNA-2 were relatively lower (68-73% and 69-76%, respectively) than those for the 5 NCR and 3 NCR of RNA1 (74-87% and 85-89%, respectively).

Recombination and reassortment

Our phylogenetic analyses provided some clues for the possible recombination and reassortment events in the BBWV2 population: i) the inconsistent grouping of the isolate K and Chinese isolate XJ14-3 in the nucleotide or amino acid sequence-based phylogenetic trees and ii) the BBWV2 isolates categorized in GS-III by group-combination. Thus, we sought to examine whether recombination and reassortment events have occurred in the BBWV2 population. To this end, the full-length nt sequences of RNA-1 and RNA-2 of 29 BBWV2 isolates were analyzed using RDP, GENECONV, BOOTSCAN, MaxChi, Chimaera, and SISCAN methods implemented in the RDP3 program with a highest acceptable P-Value set to 0.01. The analyses detected two recombination events in the analyzed BBWV population (Table 6). As expected from the phylogenetic analyses, one recombination event in RNA-1 genome was found to be occurred in the isolate K (Table 6). K was detected as a recombinant between XJ14-3 as a major parent and MB7 as a minor parent. In this recombination event, the genomic region (nt 286-2142) of XJ14-3 was replaced with the homologous region of MB7. In addition, the other recombination event was detected in the RNA-2 genome of XJ14-3, which was found to be a recombinant between K as a major parent and IP as a minor parent. This result could explain why XJ14-3 and IP belonged to the same group in the MP amino acid-based phylogenetic tree. However, no recombination events were found in the BBWV2 Korean isolate population. Therefore, it is likely that genetic exchange by recombination is infrequent in natural populations of BBWV2.
On the other hand, out of 29 isolates, sixteen isolates were analyzed as reassortments (Table 7). This result is in agreement with the phylogenetic grouping by the group-combinations between RNA-1 and RNA-2 segments (i.e. three genetic subpopulations, GS-I, GS-II and GS-III). Four isolates (BB2, RP, IP, and ME), which belonged to GS-I, were reassortants having RNA-1 of the isolate SP (as a parental isolate of RNA-1) and RNA-2 of the isolate P2 (as a parental isolate of RNA-2). Five isolates (BB5, P2, P3, RP3, and B935), which belonged to GS-II, were reassortments having RNA-1 of XJ14-3 and RNA-2 of SP as parental isolates. PatMMV was found to have MB7 RNA-1 and IA RNA-2 as parental isolates. Six isolates out of 15, which belonged to GS-III, were determined as reassortants between the isolates in the same group GS-III. In conclusion, our results suggest strongly that reassortment is a major evolutionary force in the genetic diversification of BBWV2 population in Korea.

Discussion

Major sources of evolution of plant RNA viruses are known as recombination that occurs in either segmented or un-segmented viruses and reassortment that occurs only in viruses with segmented RNAs, as well as mutation that accumulates by error prone replication mechanism (Garcia-Arenal et al., 2001; Worobey et al., 1999). Recombination has been observed in many plant viruses, such as luteoviruses (Gibbs, 1995), bromoviruses (Allison et al., 1989), nepoviruses (Le Gall et al., 1995), cucumoviruses (Fraile et al., 1997), comoviruses (Zhang et al., 2007; Boulila, 2007), and potyviruses (Seo et al., 2009; Jonson et al., 2009). The potential involvement of recombination in evolution of BBWV2 was reported by Ferrer et al. (2011) based on phylogenetic analyses of partial sequences of BBWV2 isolates collected from various regions.
In this study, we sought to investigate the possible origin, diversity, and genetic structure of BBWV2 Korean population by analyzing full genome sequences of BBWV2 isolates. To this end, we have determined complete genome sequences of 21 BBWV2 isolates collected from various host plants and analyzed their genetic diversity by comparing with previously reported sequences of 8 BBWV2 isolates (Tables 1 and 2). Based on phylogenetic analyses, BBWV2 Korean isolates were divided into two groups for RNA-1 and RNA-2 segments, respectively (Fig. 3). Most of the Korean isolates, excluding BB2 and RP7, subgrouped into II-a together with B935. The Group II-a isolates could be further divided according to the collected areas rather than their host plants. For example, SP isolated from spinach in Jangheung had 99% nt sequence identity with P2 and P3 isolated from pea in Jangheung, while SP had 93% identity with SP1 and SP2 isolated from spinach in Geomundo. Phylogenetic trees reconstructed using amino acid sequences of the mature proteins (excluding Co-Pro and MP) showed consistent grouping compared with the nt sequence-based trees (Fig. 4). Especially, isolates K and XJ14-3 showed high nt identities of 90-91% and amino acid identities of 97-100% in the same group, but they showed relatively low amino acid identities of 84% and 92% for amino acid sequences of Co-Pro and MP, respectively, and were grouped separately (Fig. 4).
One of the remarkable features of the BBWV2 Korean isolates compared to the previously reported isolates was group-combination between RNA-1 and RNA-2 segments. The isolates composed of Group I RNA-1 and Group II RNA-2 were predominant in Korea. Group-combination between RNA segments that belong to different groups could be explained by reassortment. To confirm the result of phylogenetic analyses, we investigated whether recombination and reassortment have occurred in BBWV2 population using the RDP3 program. Only two recombination events were detected in the analyzed BBWV2 population: One at Co-Pro and NTBM regions of RNA-1 of Korean isolate K and another one at MP region of RNA-2 of Chinese isolate XJ14-3 (Table 6). No recombination events were found in BBWV2 Korean isolates. The relatively high sequence variation in Co-Pro and MP regions suggests that these regions are under looser evolutionary constraints and vulnerable to mutation and recombination. In addition, our phylogenetic analyses indicate that the isolates collected in Korea during the years 2006-2012 might not be originated from the Korean isolate K reported in 2000.
Meanwhile, 16 isolates out of 29 were found to be reassortants (Table 7). This result is highly consistent with group-combination based subpopulation of GS-I, GS-II and GS-III. Four GS-I isolates (BB2, RP7, IP and ME) were reassortments having SP RNA-1 and P2 RNA-2, and five GS-II isolates (BB5, P2, P3, RP3 and B935) were reassortments having XJ14-3 RNA-1 and SP RNA-2. Six Korean isolates belonged to GS-III were determined as reassortments between the Korean isolates in the same group GS-III (Table 7). Japanese isolate PatMMV, which was detected as a reassortant, might be originated by reassortment between Japanese isolates (i.e. MB7 and IA). Collectively, our results revealed that BBWV2 Korean isolates have been evolved mainly by reassortment rather than recombination. In the case of Bean pod mottle virus (BPMV; genus Comovirus) having similar genome structures with BBWV2, reassortment events between distinct BPMV strains and recombination events at the putative helicase region of RNA-1 were reported (Zhang et al., 2007). In addition, Co-Pro and the C-termainal domain of the putative helicase of BPMV were identified as symptom severity determinants (Gu et al., 2005). Since we also found high sequence variations in Co-Pro (Fig. 5), it is worthy to examine whether Co-Pro of BBWV2 is also a pathogenicity determinant in the BBWV2-pepper pathosystem. In the present study, we have analyzed the genetic diversity and structure of the BBWV2 population mainly collected from East Asia. Our findings revealed that reassortment occurred naturally in the BBWV2 population, and might play an important role in disease incidence occurred recently in Korea. Further analyses of genetic population structure of BBWV2 with more diverse full-genome sequences of worldwide isolates will be required for in-depth understanding of the evolutionary history of BBWV2.

Acknowledgments

This research was carried out with the support of “Cooperative Research Program for Agricultural Science & Technology Development (Project No. PJ00651901)” of the Rural Development Administration and iPET (Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry, and Fisheries: No. 110034-05-3-HD110), Ministry for Food, Agriculture, Forestry, and Fisheries, Republic of Korea.

Fig. 1.
Geographical locations of the collected BBWV2 isolates in Korea.
ppj-29-397f1.gif
Fig. 2.
Symptoms induced by BBWV2 on various host plants infected naturally in Korea. (A) severe mosaic, stunting and leaf curling on Broad bean, (B) mosaic on pea leaves, (C) mosaic on spinach leaves, (D) vein clearing and mosaic on red pepper leaves, (E) severe mosaic on leaves and irregularly shaped coloring on paprika fruits and (F) chlorotic spot and mosaic on bell pepper fruits.
ppj-29-397f2.gif
Fig. 3.
Phylogenetic trees reconstructed using the complete nucleotide sequences of RNA-1or RNA-2 of the BBWV2 isolates. The Maximum likehliood method implemented in MEGA 5 was used to reconstruct the phylogenetic trees.
ppj-29-397f3.gif
Fig. 4.
Phylogenetic trees reconstructed using the amino acid sequences of the viral proteins. Co-Pro, NTBM, VPg, Pro and RdRp are encoded in RNA-1 and MP, LCP and SCP encoded in RNA-2 genome. The Maximum likelihood method implemented in MEGA 5 was used to reconstruct the phylogenetic trees.
ppj-29-397f4.gif
Fig. 5.
Alignment of the amino acid sequences of Co-Pro of the BBWV2 isolates. Sequences were aligned by the geneious method. Same amino acid sequences are indicated with a ‘·’. Arrow indicates the amino acid position 118 on the polyprotein precursor.
ppj-29-397f5.gif
Table 1.
List of Broad bean wilt virus 2 Korean isolates used in this study
Plant isolated from Isolates Area collected Year collected NCBI accession No.
RNA-1 RNA-2
Leguminosae Vicia faba BB2 Namhae 2006 KC625492 KC625506
BB5 Namhae 2006 KC625493 KC625507
BB9 Namhae 2006 KC625494 KC625508

Pisum sativum P2 Jangheung 2007 KC625498 KC625512
P3 Jangheung 2007 KC625499 KC625513

Chenopodiacea Spinacia oleracea SP Jangheung 2007 KC625505 KC625518
SP1 Geomundo 2007 KC625503 KC625516
SP2 Geomundo 2007 KC625504 KC625517

Solanaceae Capsicum annuum RP1 Cheongyang 2007 JX183221 JX183222
RP2 Cheongyang 2007 JX183223 JX183224
RP3 Yesan 2007 JX183225 JX183226
RP4 Suwon 2007 JX183227 JX183228
RP5 Yeongyang 2009 JX183229 JX183230
RP6 Imsil 2010 JX183231 JX183232
RP7 Suwon 2011 JX183233 JX183234

C. annuum var. gulosum (Paprika) PAP1 Gangjin 2010 KC625500 KC634010
PAP2 Gangjin 2010 KC625501 KC625514
PAP3 Gangjin 2011 KC625502 KC625515

C. annuum var. gulosum GP2 Hoengseong 2012 KC625495 KC625509
GP4 Hoengseong 2012 KC625496 KC625510
GP5 Hoengseong 2012 KC625496 KC625511
Table 2.
Primer pairs for full genome sequencing of BBWV2 RNA-1 and RNA-2
Group Primer Sequence (5′ → 3′) location Size (nt)
I of RNA-1 BBWV2 1-1u AAACAAACAGCTTTCGTTCCG 19-915 896
BBWV2 1-1R TTCCATGCATCGTGTTGGCC
BBWV2 1-2F ATTTCAGGCTCCATTAAAAAGAG 753-1701 948
BBWV2 1-2R TCTATCAACTTCTCCAAAGCC
BBWV2 1-3F GAATGTGATTGCATGGTGGCT 1515-2400 885
BBWV2 1-3R CAAATGAAGTGGCTATGACCGT
BBWV2 1-4F GTACACAAGGTTTAAGGAGCA 2275-3203 928
BBWV2 1-4R CCAAGCACACTTGTGTTCTCA
BBWV2 1-3u TGGGAG(A)TACAAGCAA(G)TGG C 2867-3888 1021
BBWV2 1-5R AAATGCCATTCCTCTGGGG
BBWV2 1-6F GAAGTGCCAGTTTTATGCCGT 3690-4626 936
BBWV2 1-6R TCATTCATGACACACTTGGGC
BBWV2 1-7F GGAGGGATGTTTTACCAGCT 4476-5252 776
BBWV2 1-7R CTATTGCGGAATTCCTTGGC
BBWV2 1-8F TGAATCCAGATGGCACATGG 5078-5958 880
BBWV2 1-8R CCCTCACTACTGAAATTTACTTG

II of RNA-1 BBWV2 1-1u AAACAAACAGCTTTCGTTCCG 19-1173 1154
BBWV2 1-1r CTGAAATAGCTGCCATAGCAG
BBWV2 1-2f TTTGCAGCGTGGATGCC 883-1981 1098
BBWV2 1-2r CTTGTAGCCTGACCAAAAAGG
BBWV2 1-3f GCTGATAGAGTTGCACAATTCAGT 1774-2850 1076
BBWV2 1-3r TACAAATACGCCCTTTGCCA
BBWV2 1-4f GTGGAGCAGATGCAATTGAG 2603-3664 1061
BBWV2 1-4r GAAATACTTTGGGGAATTTCCC
BBWV2 1-5f GATGTGGAAACTTTGCCCAA 3495-4390 895
BBWV2 1-5r TTGCTCACTTCTTCAAACCAAG
BBWV2 1-6f CTTGATCGTGGTCCTGGTGA 4272-5355 1083
BBWV2 1-6r TCCATCTCAAATTTCTCAAGACTT
BBWV2 1-7f TTGGAAATGGCAGAGGCAT 5239-5958 719
BBWV2 1-7R CCCTCACTACTGAAATTTACTTG

Universal of RNA-2 BBWV2 2-1F CAAACAGCTTTCGTTCCGAA 22-949 927
BBWV2 2-1R AAGCCATCTGCCACCAATTC
BBWV2 2-2F GCCATGTCAGGTGCTGGA 801-1702 900
BBWV2 2-1d CGCATA(G)GTC(T)TCT(C)GTA(G)GCA(T)GA
BBWV2 2-2u TACAAT(C)TTG(A)CCTGGG(A)CCTAGC 1377-2496 1119
BBWV2 2-2r CATGTTCCCAACCTTTTCAATGT
BBWV2 2-3u ATTT(C)TA(G)GATTTTACT(C)CTC(T)ATGAG 2348-3511 1163
BBWV2 2-3d AGGTCATGGAACCCATTTTAATGG
Table 3.
Database of the complete nucleotide sequences for BBWV isolates
Virus Isolate Host reported from Country reported NCBI accession No.
RNA1 RNA2
BBWV2 IP Capsicum annuum Japan AB023484 AB018698
ME Megaskepasma erythrochlamys Singarpore NC003003 NC003004
IA Gentiana spp. Japan AB051386 AB032403
K Capsicum annuum Korea AF144234 AF104335
B935 Vicia faba China AF149425 AJ132844
MB7 Vicia faba Japan AB013615 AB013616
XJ14-3 Lycopersicon esculentum MILL China FN985164 HQ283389
PatMMVa Pogostemon patchouli Japan NC003975 NC003974

BBWV1 PV132 Spinacia oleracea USA AB084450 AB084451
Ben Capsicum annuum Spain AY781171 AY781172

a Patchouli mild mosaic virus; an isolate of BBWV2

Table 4.
The nucleotide and amino acid sequence identities (%) between RNA-1 of the BBWV2 Korean isolate BB2 and RNA-1 of other BBWV isolates
Virus Isolate full genome (nt) 5′ NCR (nt) Co-Pro (aa) NTBM (aa) VPg (aa) Pro (aa) RdRp (aa) 3′ NCR (nt)
BBWV2 BB5 78.7 86.8 73.4 91.1 92.3 93.3 91.2 87.2
BB9 98.4 97.8 98.3 99.5 92.3 97.6 99.1 99.1
P2 78.9 86.9 73.7 91.4 92.3 93.3 91.7 88.5
P3 78.8 86.9 73.7 91.6 92.3 93.3 91.6 88.5
SP 93.2 94.3 94.6 98.5 96.2 98.6 98.3 97.4
SP1 98.4 97.8 98.3 99.0 100 100 99.3 98.3
SP2 98.5 97.8 98.0 99.3 100 99.5 99.3 98.3
RP1 95.8 97.4 95.8 98.8 100 99.0 98.7 99.1
RP2 95.1 96.1 96.0 98.5 100 99.5 98.4 97.4
RP3 78.9 86.9 73.7 91.2 92.3 93.3 91.7 89.4
RP4 92.7 95.7 92.1 98.3 96.2 98.6 98.1 98.3
RP5 95.9 96.1 96.6 99.3 100 99.0 99.0 96.6
RP6 92.8 93.1 93.8 98.3 96.2 98.1 98.6 99.1
RP7 94.7 96.1 95.2 99.0 100 99.5 98.1 96.6
PAP1 93.1 95.7 94.1 98.6 96.2 98.1 98.0 98.0
PAP2 96.6 96.5 97.2 99.1 100 100 98.9 99.1
PAP3 93.1 94.3 95.5 98.8 96.2 98.1 97.9 98.3
GP2 95.7 97.8 97.5 99.1 100 99.0 98.3 98.3
GP4 95.7 97.8 97.5 99.1 100 99.0 98.4 98.3
GP5 95.7 97.8 97.5 99.1 100 99.0 98.4 98.3

IP 96.5 98.7 96.9 99.3 96.2 99.0 98.6 97.4
ME 90.2 91.7 90.9 97.6 92.3 94.3 96.9 88.9
IA 78.5 86.4 75.7 92.1 92.3 92.8 91.8 88.5
MB7 79.5 86.9 74.0 92.1 92.3 92.3 91.7 86.0
PatMMV 79.5 87.3 73.7 91.8 92.3 92.8 92.4 87.6
B935 78.8 86.4 74.0 91.9 92.3 93.8 91.8 88.5
XJ14-3 79.1 87.2 73.4 91.4 92.3 92.8 92.4 89.1
K 78.2 74.4 70.4 90.7 92.3 93.3 91.0 85.7

BBWV1 Ben 63.2 65.7 36.8 67.2 57.7 58.9 68.0 55.4
PV132 62.9 67.2 38.9 53.8 59.8 67.2 53.3
Table 5.
The nucleotide and amino acid sequence identities (%) between RNA-2 of the BBWV2 Korean isolate BB2 and RNA-2 of other BBWV isolates
Virus Isolate full genome (nt) 5′ NCR (nt) MP (aa) LCP (aa) SCP (aa) 3′ NCR (nt)
BBWV2 BB5 79.7 73.8 85.8 93.5 93.9 75.1
BB9 79.5 73.2 86.2 93.3 94.4 74.9
P2 79.8 72.7 86.7 91.8 93.4 75.4
P3 79.9 72.3 86.7 93.8 93.9 75.4
SP 79.9 72.7 86.9 94.0 93.9 75.4
SP1 79.6 72.5 86.2 93.5 93.9 74.3
SP2 79.6 72.5 85.8 93.8 93.9 75.4
RP1 79.6 70.0 86.9 92.6 93.9 76.5
RP2 79.3 70.4 86.2 93.3 93.9 76.5
RP3 79.1 70.5 86.0 92.8 93.9 75.4
RP4 79.3 71.7 86.9 93.5 93.9 74.3
RP5 79.7 72.0 87.5 93.8 92.9 75.4
RP6 79.8 71.7 86.5 94.5 93.4 73.7
RP7 90.9 85.3 94.6 97.5 97.5 86.9
PAP1 79.7 72.3 86.2 93.8 93.4 76.0
PAP2 79.5 71.5 86.2 94.3 92.9 76.0
PAP3 79.9 72.3 86.2 94.3 93.4 75.0
GP2 79.3 71.2 86.7 94.3 93.4 76.0
GP4 79.3 71.2 86.7 94.3 93.4 76.0
GP5 79.2 71.2 86.7 94.0 93.4 75.4

IP 91.4 88.6 95.7 98.0 97.5 86.8
ME 87.4 78.8 92.3 93.8 93.4 66.3
IA 78.6 73.3 84.1 93.8 90.9 74.0
MB7 78.9 71.2 84.7 94.0 92.4 72.8
PatMMV 78.9 71.6 86.2 85.1 91.9 73.5
B935 79.1 72.0 86.1 93.8 91.9 75.4
XJ14-3 81.6 70.7 92.0 93.3 92.9 71.4
K 78.6 68.2 88.8 93.5 92.9 69.9

BBWV1 Ben 59.1 58.8 52.4 63.4 59.4 50.0
PV132 58.4 62.4 53.1 63.7 57.9 51.4
Table 6.
Recombination in the BBWV2 population detected by recombination detection programs
Genome Recombination site Recombinant Parental isolatesa RDP3 (P-value)b
RNA1 nt 286-2142 K XJ14-3 × MB7 RGBMCS (7.8 × 10−69)
RNA2 nt 484-1399 XJ14-3 K × IP RGBMCS (3.3 × 10−33)

a Parental isolatested by recombination deteclate among analyzed isolates; Major parent × minor parent.

b RDP3-implemented methods supporting the corresponding recombination sites; R (RDP), G (GENECONV), B (BOOTSCAN), M (MAXCHI), C (CHIMAERA), and S (SISCAN). The reported P-value in parentheses is the greatest P-value among the calculated P-values using RDP3 implemented methods and the corresponding method is shown boldface.

Table 7.
Reassortment in the BBWV2 population detected by recombination detection programs
Reassortanta Parental isolatesb
RDP3 (P-value)c
RNA1 RNA2
BB2, RP7, IP, MEd SP Unknown (P2) RGBMCS (3.2 × 10−247)
BB5, P2, P3, RP3, B935 XJ14-3 SP RGBMCS (5.4 × 10−142)
PatMMV MB7 IA RBMCS (5.0 × 10−30)
SP, PAP1 RP6 PAP3 RGBMCS (9.1 × 10−21)
SP1, SP2d RP1 Unknown (RP2) RMCS (6.4 × 10−12)
BB9e SP1 RP6 MC (2.4 × 10−18)
PAP2 BB9 SP RGBMCS (2.1 × 10−27)

a Some reassortants seemed to be ion programshe corresponding method is shown boldface. (Gd, ome reassortants seemed to be ion programshe corresponding me; e, reassortants seemed to be ion programshe c3 methods.

b e, reassortants seemed to be ion programshe c3 methodsing method is sho

c RDP3-implemented methods supporting the corresponding reassortments; R (RDP), G (GENECONV), B (BOOTSCAN), M (MAXCHI), C (CHIMAERA), and S (SISCAN). The reported P-value in parentheses is the greatest P-value among the calculated P-values using RDP3-implemented methods and the corresponding method is shown boldface.

References

Allison, RF, Janda, M and Ahlquist, P 1989. Sequence of cowpea chlorotic mottle virus RNAs 2 and 3 and evidence of a recombination event during bromovirus evolution. Virology. 172:321-330.
crossref pmid
Benner, CP, Kuhn, CW, Demski, JW, Dobson, JW, Colditz, P and Nutter, FW Jr 1985. Identification and incidence of pepper viruses in Northeastern Georgia. Plant Dis. 69:999-1001.
Boulila, M 2007. Phylogeny and genetic recombination of Grapevine fanleaf virus isolated from naturally infected vineyards in Tunisia. Phytopathol Mediterr. 46:285-294.
Brunt, AA, Crabtree, K, Dallwitz, MJ, Gibbs, AJ and Watson, L 1996. Viruses of Plants. Descriptions and Lists from the VIDE Database. CAB International, Wallingford, UK.
Chang, MU and Chung, JD 1987. Studies on viruses isolated from Lilium spp. in Korea. Plant Pathol J. 3:223-235.
Cho, JD, Kim, JS, Lee, SH, Choi, GS and Chung, B 2007 Viruses and symptoms on peppers and their infection types in Korea. Res Plant Dis. 13:75-81 (in Korean)..
crossref
Choi, HS, Cho, JD, Lee, KH and Kim, JS 2001. Broad bean wilt fabaviruses and their specific ultrastructures. Kor J Electron Microscopy. 31:215-222.
Ferrer, R, Ferriol, I, Gueri, J, Moreno, P and Rubio, L 2011. Genetic variation and evolutionary analysis of Broad bean wilt virus 2. Arch Virol. 156:1445-1450.
crossref pmid pdf
Fraile, A, Alonso-Prados, JL, Aranda, MA, Bernal, JJ, Malpica, JM and Garcia-Arenal, F 1997. Genetic exchange by recombination or reassortment is infrequent in natural populations of a tripartite RNA plant virus. J Virol. 71:934-940.
crossref pmid pmc pdf
Garcia-Arenal, F, Fraile, A and Malpica, JM 2001. Variability and genetic structure of plant virus populations. Annu Rev Phytopathol. 39:157-186.
crossref pmid
Gibbs, MJ, Armstrong, JS and Gibbs, AJ 2000. Sister-scanning: a Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics. 16:573-582.
crossref pmid
Goldbach, R, Martelli, GP and Milne, RG 1995. Family Comoviridae. In: Virus taxonomy. Classification and nomenclature of viruses. Sixth report of the International Committee on Taxonomy of Viruses, eds. by FA Murphy, CM Fauquet, DHL Bishop, SA Ghabrial, AW Jarvis, GP Martelli, MA Mayo and MD Summers, 341-347 Springer, Wien New York. (Arch Virol [Suppl] 10)..
Gu, H and Ghabrial, SA 2005. The Bean pod mottle virus proteinase cofactor and putative helicase are symptom severity determinants. Virology. 333:271-283.
crossref pmid
Hahm, YI, Kwon, M, Kim, JS, Seo, HW and Ahn, JH 1998. Serveys on disease occurrence in major horticultural crops in Kangwon Alpine areas. Plant Pathol J. 14:668-675.
Ikegami, M, Kawashima, H, Natsuaki, T and Sugimura, N 1998. Complete nucleotide sequence of the genome organization of RNA2 of Patchouli mild mosaic virus, a new fabavirus. Arch Virol. 143:2431-2434.
crossref pmid pdf
Ikegami, M, Onobori, Y, Sugimura, N and Natsuaki, T 2001. Complete nucleotide sequence and the genome organization of Patchouli mild mosaic virus RNA1. Intervirology. 44:355-358.
crossref pmid pdf
Jonson, MG, Seo, JK, Choi, HS, Kim, JS and Kim, KH 2009. Effects of Recombination on the pathogenicity and evolution of Pepper mottle virus. Plant Pathol J. 25:417-421.
crossref
Kobayashi, YO, Mikoshiba, Y, Honda, Y and Omura, T 2004. Detection of Broad bean wilt virus 1 and Broad bean wilt virus 2 in Japan. Ann Rept Kanto Plant Prot Soc. 51:43-48.
Kobayashi, YO, Nakano, M, Kashiwazaki, S, Naito, T, Mikoshiba, Y, Shiota, A, Kameya-Iwaki, M and Honda, Y 1999. Sequence analysis of RNA-2 of different isolates of broad bean wilt virus confirms the existence of two distinct species. Arch Virol. 144:1429-1438.
crossref pmid pdf
Kobayashi, YO, Kobayashi, A, Nakano, M, Hagiwara, K, Honda, Y and Omura, T 2003. Analysis of genetic relations between Broad bean wilt virus 1 and Broad bean wilt virus 2. J Gen Plant Pathol. 69:320-326.
crossref pdf
Kobayashi, YO, Nakano, M, Kashiwazaki, S, Naito, T, Mokoshiba, Y, Shiota, A, Kameya-Iwaki, M and Honda, Y 1999. Sequence analysis of RNA-2 of different isolates of broad bean wilt virus confirms the existence of two distinct species. Arch Virol. 144:1429-1438.
crossref pmid pdf
Koh, LH, Cooper, JI and Wong, SM 2001. Complete sequences and phylogenetic analyses of a Singapore isolate of Broad bean wilt fabavirus. Arch Virol. 146:135-147.
crossref pmid pdf
Kondo, T, Fuji, S, Yamashita, K, Kang, DK and Chang, MU 2005. Broad bean wilt virus 2 in yams. J Gen Plant Pathol. 71:441-443.
crossref pdf
Kuroda, T, Okumura, A, Takeda, L, Miura, Y and Suzuki, K 2000. Nucleotide sequence and synthesis of infectious RNA from cloned cDNA of Broad bean wilt virus 2 RNA 2. Arch Virol. 145:787-793.
crossref pmid pdf
Kwak, HR, Kim, MK, Nam, M, Kim, JS, Kim, KH, Cha, B and Choi, HS 2013 Genetic compositions of Broad bean wilt virus 2 infecting red pepper in Korea. Plant Pathology J. (in press)..
crossref
Lee, U, Hong, JS, Choi, JK, Kim, KC, Kim, YS, Curtis, IS, Nam, HG and Lim, PO 2000. Broad bean wilt virus causes necrotic symptoms and generates defective RNAs in Capsicum annuum. Phytopathology. 90:1390-1395.
crossref pmid
Lee, SH, Lee, KW and Chung, BJ 1979. Investigations on the virus diseases in spinach (Spinacia oleracea L.) 2. Identification of Broad bean wilt virus occuring spinach. Kor J Plant Port. 18:11-14.
Le Gall, O, Candresse, T and Dunez, J 1995. Transfer of the 39 non-translated region of grapevine chrome mosaic virus RNA-1 by recombination to tomato black ring virus RNA-2 in pseudorecombinant isolates. J Gen Virol. 76:1285-1289.
pmid
Lisa, V and Boccardo, G 1996. Fabaviruses: broad bean wilt and allied viruses. In: The plant viruses, vol. 5: Polyhedral virions and bipartite RNA genomes, eds. by BD Harrison and AF Murant, 229-250. Plenum Press, New York.
crossref
Nakamura, S, Iwai, T and Honkura, R 1998. Complete nucleotide sequence and genome organization of Broad bean wilt virus 2. Ann Phytopathol Soc Jpn. 64:565-568.
crossref
Park, IS, Kim, KW, Kyun, HJ and Chang, MU 1998. The viruses in gladiolus hybridus cultivated in Korea 2. Broad bean wilt virus, Cucumber mosaic virus and Tobacco rattle virus. Plant Pathol J. 14:83-91.
Qi, Y, Zhou, X and Li, D 2000a. Complete nucleotide sequence and infectious cDNA clone of the RNA1 of a Chinese isolate of Broad bean wilt virus 2. Virus Genes. 20:201-207.
crossref pmid pdf
Qi, Y, Zhou, X, Xue, C and Li, D 2000b. Nucleotide sequence of RNA2 and polyprotein processing sites of a Chinese isolate of Broad bean wilt virus 2. Prog Nat Sci. 10:680-686.
Roh, SH and Chang, MU 1998. Three viruses isolated from Gentiana spp. in Korea. Plant Pathol J. 14:425-432.
Ryu, JG, Ko, SJ, Lee, YH, Kim, MK, Kim, KH, Kim, HT and Choi, HS 2009. Incidence and distribution of virus disease on paprika (Capsicum annuum var. grossum) in Jeonnam province of Korea. Plant Pathol J. 25:95-98.
Seo, JK, Ohshima, K, Lee, HG, Son, M, Choi, HS, Lee, SH, Sohn, SH and Kim, KH 2009. Molecular variability and genetic structure of the population of Soybean mosaic virus based on the analysis of complete genome sequences. Virology. 393:91-103.
crossref pmid
Sui, C, Wei, JH, Zhan, QQ and Zhang, J 2009. First report of Broad bean wilt virus 2 infecting Bupleurum chinense in China. Plant Dis. 93:844.
crossref
Tamura, K, Peterson, D, Peterson, N, Stecher, G, Nei, M and Kumar, S 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 28:2731-2739.
crossref pmid pmc
Taylor, RH and Stubbs, LL 1972 Broad bean wilt virus. Page 81 in: Description of Plant Viruses. Commonw. Mycol. Inst./Assoc. Appl. Biol., Warwick, U.K.
Uyemoto, KJ and Provvidenti, R 1974. Isolation and identification of two serotypes of Broad bean wilt virus. Phytopathology. 64:1547-1548.
crossref
Watterson, JC 1993. Development and breeding of resistance to pepper and tomato viruses. In: Resistance to Viral Diseases of Vegetables, eds. by MM Kyle, 80-101. Timber Press, Portland OR.
Worobey, M and Holmes, EC 1999. Evolutionary aspects of recombination in RNA viruses. J Gen Virol. 80:2535-2543.
crossref pmid
Zhang, C, Gu, H and Ghabrial, SA 2007. Molecular characterization of naturally occurring RNA1 recombinants of the Comovirus Bean pod mottle virus. Phytopathology. 97:1255-1262.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2025 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next